EMAIL THIS PAGE TO A FRIEND

PLEKHA6

pleckstrin homology domain containing, family A member 6

137 Gene Product Result for
Synonyms: PEPP-3 PEPP3
UniProtKB ID: Q9Y2H5, A7MD51, Q5VTI6
Gene ID:
Mouse(240753) pleckstrin homology domain containing, family A member 6
Rat(360842) pleckstrin homology domain containing, family A member 6
Zebrafish(568764) pleckstrin homology domain containing, family A member 6
chicken(419821) pleckstrin homology domain containing, family A member 6
domestic cat(101083736) pleckstrin homology domain containing, family A member 6
Horse(100050048) pleckstrin homology domain containing, family A member 6
dog(478936) pleckstrin homology domain containing, family A member 6
cow(532773) pleckstrin homology domain containing, family A member 6
domestic guinea pig(100723113) pleckstrin homology domain containing, family A member 6
naked mole-rat(101722630) pleckstrin homology domain containing, family A member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014935 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153461 MISSION® esiRNA esiRNA human PLEKHA6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014935 Rosetta Predictions human pricing
XM_001060716 Rosetta Predictions rat pricing
XM_341118 Rosetta Predictions rat pricing
NM_182930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122828 predicted 2996
2 SASI_Hs01_00122829 predicted 3035
3 SASI_Hs01_00122832 predicted 662
4 SASI_Hs01_00122833 predicted 600
5 SASI_Hs01_00122834 predicted 2213
6 SASI_Hs01_00122835 predicted 679
7 SASI_Hs01_00122836 predicted 994
8 SASI_Hs01_00122837 predicted 1879
9 SASI_Hs02_00346598 predicted 2163
10 SASI_Hs02_00346599 predicted 1903
11 SASI_Hs01_00122830 predicted 3181
12 SASI_Hs01_00122831 predicted 2596
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297453 predicted 3706
2 SASI_Rn02_00297454 predicted 3805
3 SASI_Rn02_00297455 predicted 593
4 SASI_Rn02_00297456 predicted 3827
5 SASI_Rn02_00297457 predicted 312
6 SASI_Rn02_00297458 predicted 198
7 SASI_Rn02_00297459 predicted 3271
8 SASI_Rn02_00297460 predicted 1893
9 SASI_Rn02_00297461 predicted 233
10 SASI_Rn02_00297462 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392411 predicted 3863
2 SASI_Rn02_00392412 predicted 3974
3 SASI_Rn02_00392413 predicted 3299
4 SASI_Rn02_00392414 predicted 2869
5 SASI_Rn02_00392415 predicted 893
6 SASI_Rn02_00392416 predicted 3981
7 SASI_Rn02_00392417 predicted 638
8 SASI_Rn02_00392418 predicted 3437
9 SASI_Rn02_00392419 predicted 2135
10 SASI_Rn02_00392420 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127197 predicted 2759
2 SASI_Mm01_00127198 predicted 2249
3 SASI_Mm01_00127199 predicted 1916
4 SASI_Mm01_00127200 predicted 2871
5 SASI_Mm01_00127201 predicted 369
6 SASI_Mm01_00127202 predicted 1805
7 SASI_Mm01_00127203 predicted 472
8 SASI_Mm01_00127204 predicted 2277
9 SASI_Mm01_00127205 predicted 3373
10 SASI_Mm02_00349986 predicted 3366
11 SASI_Mm01_00127206 predicted 2938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014935
PLEKHA6 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A member 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014935.2-1877s1c1
Sequence:CCGGCCACACCTACAAGTTAAACGACTCGAGTCGTTTAACTTGTAGGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014935.2-2149s21c1
Sequence:CCGGCAAACAGCACCATAGAGTATGCTCGAGCATACTCTATGGTGCTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014935.2-1003s21c1
Sequence:CCGGAGAAAGAGCCTCCGGTGAAAGCTCGAGCTTTCACCGGAGGCTCTTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014935.2-3038s1c1
Sequence:CCGGCCAGCATTATGACGTGGACATCTCGAGATGTCCACGTCATAATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014935.2-7058s1c1
Sequence:CCGGGCCAATTTGATTTGCTAGTATCTCGAGATACTAGCAAATCAAATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014935.2-2220s1c1
Sequence:CCGGCTCAATTTGGACACCCAGAATCTCGAGATTCTGGGTGTCCAAATTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014935.2-3091s21c1
Sequence:CCGGTCATCCCTGAACGGTACATTGCTCGAGCAATGTACCGTTCAGGGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014935
PLEKHA6 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A member 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014935.2-1877s1c1
Sequence:CCGGCCACACCTACAAGTTAAACGACTCGAGTCGTTTAACTTGTAGGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014935.2-2149s21c1
Sequence:CCGGCAAACAGCACCATAGAGTATGCTCGAGCATACTCTATGGTGCTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014935.2-1003s21c1
Sequence:CCGGAGAAAGAGCCTCCGGTGAAAGCTCGAGCTTTCACCGGAGGCTCTTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014935.2-3038s1c1
Sequence:CCGGCCAGCATTATGACGTGGACATCTCGAGATGTCCACGTCATAATGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014935.2-7058s1c1
Sequence:CCGGGCCAATTTGATTTGCTAGTATCTCGAGATACTAGCAAATCAAATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014935.2-2220s1c1
Sequence:CCGGCTCAATTTGGACACCCAGAATCTCGAGATTCTGGGTGTCCAAATTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014935.2-3091s21c1
Sequence:CCGGTCATCCCTGAACGGTACATTGCTCGAGCAATGTACCGTTCAGGGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014935
PLEKHA6 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A member 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014935.2-1877s1c1
Sequence:CCGGCCACACCTACAAGTTAAACGACTCGAGTCGTTTAACTTGTAGGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014935.2-2149s21c1
Sequence:CCGGCAAACAGCACCATAGAGTATGCTCGAGCATACTCTATGGTGCTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014935.2-1003s21c1
Sequence:CCGGAGAAAGAGCCTCCGGTGAAAGCTCGAGCTTTCACCGGAGGCTCTTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014935.2-3038s1c1
Sequence:CCGGCCAGCATTATGACGTGGACATCTCGAGATGTCCACGTCATAATGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014935.2-7058s1c1
Sequence:CCGGGCCAATTTGATTTGCTAGTATCTCGAGATACTAGCAAATCAAATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014935.2-2220s1c1
Sequence:CCGGCTCAATTTGGACACCCAGAATCTCGAGATTCTGGGTGTCCAAATTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014935.2-3091s21c1
Sequence:CCGGTCATCCCTGAACGGTACATTGCTCGAGCAATGTACCGTTCAGGGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182930
PLEKHA6 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A member 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182930.1-356s1c1
Sequence:CCGGGCAGTGGAATAAGCGTTGGTTCTCGAGAACCAACGCTTATTCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182930.1-3360s1c1
Sequence:CCGGGAGAGGATCAAGACGCTCATTCTCGAGAATGAGCGTCTTGATCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182930.1-4792s1c1
Sequence:CCGGCGGAGGAGGAATGAGGAATTACTCGAGTAATTCCTCATTCCTCCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182930.1-1172s1c1
Sequence:CCGGCCCTGACTATTACAATCCCTACTCGAGTAGGGATTGTAATAGTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182930.1-5353s1c1
Sequence:CCGGCCTCCTTAAAGACTGGTAGATCTCGAGATCTACCAGTCTTTAAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182930.1-4925s1c1
Sequence:CCGGGCAGAGCAGAATCTTCCTCTACTCGAGTAGAGGAAGATTCTGCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182930.1-2030s1c1
Sequence:CCGGGAGCCTAGAAAGTGCCTTGATCTCGAGATCAAGGCACTTTCTAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182930
PLEKHA6 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A member 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182930.1-356s1c1
Sequence:CCGGGCAGTGGAATAAGCGTTGGTTCTCGAGAACCAACGCTTATTCCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182930.1-3360s1c1
Sequence:CCGGGAGAGGATCAAGACGCTCATTCTCGAGAATGAGCGTCTTGATCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182930.1-4792s1c1
Sequence:CCGGCGGAGGAGGAATGAGGAATTACTCGAGTAATTCCTCATTCCTCCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182930.1-1172s1c1
Sequence:CCGGCCCTGACTATTACAATCCCTACTCGAGTAGGGATTGTAATAGTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182930.1-5353s1c1
Sequence:CCGGCCTCCTTAAAGACTGGTAGATCTCGAGATCTACCAGTCTTTAAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182930.1-4925s1c1
Sequence:CCGGGCAGAGCAGAATCTTCCTCTACTCGAGTAGAGGAAGATTCTGCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182930.1-2030s1c1
Sequence:CCGGGAGCCTAGAAAGTGCCTTGATCTCGAGATCAAGGCACTTTCTAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182930
PLEKHA6 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A member 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182930.1-356s1c1
Sequence:CCGGGCAGTGGAATAAGCGTTGGTTCTCGAGAACCAACGCTTATTCCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182930.1-3360s1c1
Sequence:CCGGGAGAGGATCAAGACGCTCATTCTCGAGAATGAGCGTCTTGATCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182930.1-4792s1c1
Sequence:CCGGCGGAGGAGGAATGAGGAATTACTCGAGTAATTCCTCATTCCTCCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182930.1-1172s1c1
Sequence:CCGGCCCTGACTATTACAATCCCTACTCGAGTAGGGATTGTAATAGTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182930.1-5353s1c1
Sequence:CCGGCCTCCTTAAAGACTGGTAGATCTCGAGATCTACCAGTCTTTAAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182930.1-4925s1c1
Sequence:CCGGGCAGAGCAGAATCTTCCTCTACTCGAGTAGAGGAAGATTCTGCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182930.1-2030s1c1
Sequence:CCGGGAGCCTAGAAAGTGCCTTGATCTCGAGATCAAGGCACTTTCTAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)