EMAIL THIS PAGE TO A FRIEND

PLEKHA7

pleckstrin homology domain containing, family A member 7

119 Gene Product Result for
UniProtKB ID: Q6IQ23, B4DK33, B4DWC3, Q86VZ7
Gene ID:
Mouse(233765) pleckstrin homology domain containing, family A member 7
Rat(499249) pleckstrin homology domain containing, family A member 7
naked mole-rat(101700425) pleckstrin homology domain containing, family A member 7
domestic guinea pig(100721592) pleckstrin homology domain containing, family A member 7
cow(528261) pleckstrin homology domain containing, family A member 7
sheep(101120777) pleckstrin homology domain containing, family A member 7
chicken(423069) pleckstrin homology domain containing, family A member 7
dog(476874) pleckstrin homology domain containing, family A member 7
Horse(100071729) pleckstrin homology domain containing, family A member 7
domestic cat(101095612) pleckstrin homology domain containing, family A member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175058 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175058 Rosetta Predictions human pricing
XM_001078528 Rosetta Predictions rat pricing
XM_574542 Rosetta Predictions rat pricing
NM_172743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054762 predicted 2131
2 SASI_Hs01_00054763 predicted 290
3 SASI_Hs01_00054764 predicted 2142
4 SASI_Hs01_00054765 predicted 3350
5 SASI_Hs01_00054766 predicted 2723
6 SASI_Hs01_00054768 predicted 870
7 SASI_Hs01_00054769 predicted 1467
8 SASI_Hs01_00054771 predicted 2045
9 SASI_Hs02_00368957 predicted 1199
10 SASI_Hs02_00368958 predicted 428
11 SASI_Hs01_00054767 predicted 444
12 SASI_Hs01_00054770 predicted 2162
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361119 predicted 686
2 SASI_Rn02_00361120 predicted 2035
3 SASI_Rn02_00361121 predicted 3144
4 SASI_Rn02_00361122 predicted 1476
5 SASI_Rn02_00361123 predicted 1337
6 SASI_Rn02_00361124 predicted 2473
7 SASI_Rn02_00361125 predicted 1958
8 SASI_Rn02_00361126 predicted 2831
9 SASI_Rn02_00361127 predicted 2143
10 SASI_Rn02_00361128 predicted 1789
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122898 predicted 1557
2 SASI_Rn01_00122899 predicted 1672
3 SASI_Rn01_00122900 predicted 823
4 SASI_Rn01_00122901 predicted 5764
5 SASI_Rn01_00122902 predicted 7153
6 SASI_Rn01_00122903 predicted 910
7 SASI_Rn01_00122904 predicted 812
8 SASI_Rn01_00122905 predicted 931
9 SASI_Rn01_00122906 predicted 2876
10 SASI_Rn01_00122907 predicted 1608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058238 predicted 1772
2 SASI_Mm01_00058239 predicted 1957
3 SASI_Mm01_00058240 predicted 2647
4 SASI_Mm01_00058241 predicted 1338
5 SASI_Mm01_00058242 predicted 3539
6 SASI_Mm01_00058243 predicted 1961
7 SASI_Mm01_00058244 predicted 3020
8 SASI_Mm01_00058246 predicted 2515
9 SASI_Mm01_00058245 predicted 1597
10 SASI_Mm01_00058247 predicted 3442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175058
PLEKHA7 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A member 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175058.4-966s21c1
Sequence:CCGGACCCGGACATACGAGAGATTGCTCGAGCAATCTCTCGTATGTCCGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-1220s1c1
Sequence:CCGGCGAATACCTGAAGTTGGAGAACTCGAGTTCTCCAACTTCAGGTATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175058.4-682s21c1
Sequence:CCGGGATCGCATAAGCCGCAAATATCTCGAGATATTTGCGGCTTATGCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-1448s1c1
Sequence:CCGGGCCTTCACTCTCAACTTCTGACTCGAGTCAGAAGTTGAGAGTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-975s1c1
Sequence:CCGGCTGAGCATCTTCTGTGAACAACTCGAGTTGTTCACAGAAGATGCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-2236s1c1
Sequence:CCGGCTGGAGATCTTGGCTCAGTATCTCGAGATACTGAGCCAAGATCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-912s1c1
Sequence:CCGGGACCTTCTCAAGGATCGAAGTCTCGAGACTTCGATCCTTGAGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-1355s1c1
Sequence:CCGGCCTGAGTGCAAATAAAGAGAACTCGAGTTCTCTTTATTTGCACTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175058
PLEKHA7 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A member 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175058.4-966s21c1
Sequence:CCGGACCCGGACATACGAGAGATTGCTCGAGCAATCTCTCGTATGTCCGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-1220s1c1
Sequence:CCGGCGAATACCTGAAGTTGGAGAACTCGAGTTCTCCAACTTCAGGTATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175058.4-682s21c1
Sequence:CCGGGATCGCATAAGCCGCAAATATCTCGAGATATTTGCGGCTTATGCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-1448s1c1
Sequence:CCGGGCCTTCACTCTCAACTTCTGACTCGAGTCAGAAGTTGAGAGTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-975s1c1
Sequence:CCGGCTGAGCATCTTCTGTGAACAACTCGAGTTGTTCACAGAAGATGCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-2236s1c1
Sequence:CCGGCTGGAGATCTTGGCTCAGTATCTCGAGATACTGAGCCAAGATCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-912s1c1
Sequence:CCGGGACCTTCTCAAGGATCGAAGTCTCGAGACTTCGATCCTTGAGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-1355s1c1
Sequence:CCGGCCTGAGTGCAAATAAAGAGAACTCGAGTTCTCTTTATTTGCACTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175058
PLEKHA7 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A member 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175058.4-966s21c1
Sequence:CCGGACCCGGACATACGAGAGATTGCTCGAGCAATCTCTCGTATGTCCGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-1220s1c1
Sequence:CCGGCGAATACCTGAAGTTGGAGAACTCGAGTTCTCCAACTTCAGGTATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175058.4-682s21c1
Sequence:CCGGGATCGCATAAGCCGCAAATATCTCGAGATATTTGCGGCTTATGCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-1448s1c1
Sequence:CCGGGCCTTCACTCTCAACTTCTGACTCGAGTCAGAAGTTGAGAGTGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-975s1c1
Sequence:CCGGCTGAGCATCTTCTGTGAACAACTCGAGTTGTTCACAGAAGATGCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-2236s1c1
Sequence:CCGGCTGGAGATCTTGGCTCAGTATCTCGAGATACTGAGCCAAGATCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-912s1c1
Sequence:CCGGGACCTTCTCAAGGATCGAAGTCTCGAGACTTCGATCCTTGAGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175058.2-1355s1c1
Sequence:CCGGCCTGAGTGCAAATAAAGAGAACTCGAGTTCTCTTTATTTGCACTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172743
VALIDATED
PLEKHA7 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family A member 7
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172743.1-3547s1c1
Sequence:CCGGCGGATAATCAACATTTCCTATCTCGAGATAGGAAATGTTGATTATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172743.1-1972s1c1
Sequence:CCGGGAGAATAAAGATCAGCTAGAACTCGAGTTCTAGCTGATCTTTATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172743.1-1893s1c1
Sequence:CCGGCATTGATGTCAAGCTGAGCATCTCGAGATGCTCAGCTTGACATCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172743.1-1244s1c1
Sequence:CCGGCCAAGAGCACTAGACATCTTTCTCGAGAAAGATGTCTAGTGCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172743.2-3972s1c1
Sequence:CCGGCATAGGGATTCAGGTACTATGCTCGAGCATAGTACCTGAATCCCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172743.2-1971s21c1
Sequence:CCGGGAGAATAAAGATCAGCTAGAACTCGAGTTCTAGCTGATCTTTATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172743.2-593s21c1
Sequence:CCGGGGGCATGAGGACCTACTACTTCTCGAGAAGTAGTAGGTCCTCATGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172743.2-853s21c1
Sequence:CCGGAGGAACGCTTCCGTGCTCAAACTCGAGTTTGAGCACGGAAGCGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172743.2-4118s21c1
Sequence:CCGGTACGCTGTCCAGGAAATTAACCTCGAGGTTAATTTCCTGGACAGCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172743.2-1892s21c1
Sequence:CCGGCATTGATGTCAAGCTGAGCATCTCGAGATGCTCAGCTTGACATCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172743.1-2289s1c1
Sequence:CCGGGAGTGCGAATAAAGAGAACTACTCGAGTAGTTCTCTTTATTCGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172743
VALIDATED
PLEKHA7 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family A member 7
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172743.1-3547s1c1
Sequence:CCGGCGGATAATCAACATTTCCTATCTCGAGATAGGAAATGTTGATTATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172743.1-1972s1c1
Sequence:CCGGGAGAATAAAGATCAGCTAGAACTCGAGTTCTAGCTGATCTTTATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172743.1-1893s1c1
Sequence:CCGGCATTGATGTCAAGCTGAGCATCTCGAGATGCTCAGCTTGACATCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172743.1-1244s1c1
Sequence:CCGGCCAAGAGCACTAGACATCTTTCTCGAGAAAGATGTCTAGTGCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172743.2-3972s1c1
Sequence:CCGGCATAGGGATTCAGGTACTATGCTCGAGCATAGTACCTGAATCCCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172743.2-1971s21c1
Sequence:CCGGGAGAATAAAGATCAGCTAGAACTCGAGTTCTAGCTGATCTTTATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172743.2-593s21c1
Sequence:CCGGGGGCATGAGGACCTACTACTTCTCGAGAAGTAGTAGGTCCTCATGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172743.2-853s21c1
Sequence:CCGGAGGAACGCTTCCGTGCTCAAACTCGAGTTTGAGCACGGAAGCGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172743.2-4118s21c1
Sequence:CCGGTACGCTGTCCAGGAAATTAACCTCGAGGTTAATTTCCTGGACAGCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172743.2-1892s21c1
Sequence:CCGGCATTGATGTCAAGCTGAGCATCTCGAGATGCTCAGCTTGACATCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172743.1-2289s1c1
Sequence:CCGGGAGTGCGAATAAAGAGAACTACTCGAGTAGTTCTCTTTATTCGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172743
VALIDATED
PLEKHA7 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family A member 7
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172743.1-3547s1c1
Sequence:CCGGCGGATAATCAACATTTCCTATCTCGAGATAGGAAATGTTGATTATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172743.1-1972s1c1
Sequence:CCGGGAGAATAAAGATCAGCTAGAACTCGAGTTCTAGCTGATCTTTATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172743.1-1893s1c1
Sequence:CCGGCATTGATGTCAAGCTGAGCATCTCGAGATGCTCAGCTTGACATCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172743.1-1244s1c1
Sequence:CCGGCCAAGAGCACTAGACATCTTTCTCGAGAAAGATGTCTAGTGCTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172743.2-3972s1c1
Sequence:CCGGCATAGGGATTCAGGTACTATGCTCGAGCATAGTACCTGAATCCCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172743.2-1971s21c1
Sequence:CCGGGAGAATAAAGATCAGCTAGAACTCGAGTTCTAGCTGATCTTTATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172743.2-593s21c1
Sequence:CCGGGGGCATGAGGACCTACTACTTCTCGAGAAGTAGTAGGTCCTCATGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172743.2-853s21c1
Sequence:CCGGAGGAACGCTTCCGTGCTCAAACTCGAGTTTGAGCACGGAAGCGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172743.2-4118s21c1
Sequence:CCGGTACGCTGTCCAGGAAATTAACCTCGAGGTTAATTTCCTGGACAGCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172743.2-1892s21c1
Sequence:CCGGCATTGATGTCAAGCTGAGCATCTCGAGATGCTCAGCTTGACATCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172743.1-2289s1c1
Sequence:CCGGGAGTGCGAATAAAGAGAACTACTCGAGTAGTTCTCTTTATTCGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)