EMAIL THIS PAGE TO A FRIEND

PLEKHG1

pleckstrin homology domain containing, family G (with RhoGef domain) member 1

98 Gene Product Result for
Synonyms: ARHGEF41
UniProtKB ID: Q9ULL1, Q5T1F2
Gene ID:
Mouse(213783) pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Rat(679812) pleckstrin homology domain containing, family G (with RhoGef domain) member 1
domestic guinea pig(100724368) pleckstrin homology domain containing, family G (with RhoGef domain) member 1
naked mole-rat(101720347) pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Domestic Rabbit(100341789) pleckstrin homology domain containing, family G (with RhoGef domain) member 1
cow(525772) pleckstrin homology domain containing, family G (with RhoGef domain) member 1
sheep(101101993) pleckstrin homology domain containing, family G (with RhoGef domain) member 1
chicken(421632) pleckstrin homology domain containing, family G (with RhoGef domain) member 1
domestic cat(101100393) pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Horse(100063506) pleckstrin homology domain containing, family G (with RhoGef domain) member 1
dog(484035) pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033253 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033253 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033253 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_027307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_027307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_027307 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029884 Rosetta Predictions human pricing
XM_001054556 Rosetta Predictions rat pricing
NM_001033253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191378 predicted 3639
2 SASI_Hs02_00307567 predicted 3426
3 SASI_Hs02_00307568 predicted 4332
4 SASI_Hs01_00191380 predicted 3622
5 SASI_Hs01_00191381 predicted 2503
6 SASI_Hs01_00191382 predicted 3265
7 SASI_Hs02_00307569 predicted 3851
8 SASI_Hs01_00191383 predicted 3416
9 SASI_Hs01_00191384 predicted 908
10 SASI_Hs02_00307570 predicted 2742
11 SASI_Hs01_00191376 predicted 3576
12 SASI_Hs01_00191377 predicted 1371
13 SASI_Hs01_00191379 predicted 4572
14 SASI_Hs01_00191385 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276263 predicted 905
2 SASI_Rn02_00276264 predicted 820
3 SASI_Rn02_00276265 predicted 1654
4 SASI_Rn02_00276266 predicted 1772
5 SASI_Rn02_00276267 predicted 454
6 SASI_Rn02_00276268 predicted 415
7 SASI_Rn02_00276269 predicted 1500
8 SASI_Rn02_00276270 predicted 667
9 SASI_Rn02_00276271 predicted 1069
10 SASI_Rn02_00276272 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032403 predicted 280
2 SASI_Mm02_00288419 predicted 741
3 SASI_Mm01_00032404 predicted 2938
4 SASI_Mm02_00288420 predicted 652
5 SASI_Mm01_00032405 predicted 2612
6 SASI_Mm01_00032406 predicted 3291
7 SASI_Mm02_00288421 predicted 1611
8 SASI_Mm01_00032407 predicted 2300
9 SASI_Mm01_00032408 predicted 4208
10 SASI_Mm01_00032410 predicted 3855
11 SASI_Mm01_00032409 predicted 3527
12 SASI_Mm01_00032411 predicted 2177
13 SASI_Mm01_00032412 predicted 2665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033253
PLEKHG1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-2667s21c1
Sequence:CCGGATAAGGCTCTGTCCGACAAATCTCGAGATTTGTCGGACAGAGCCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-3961s21c1
Sequence:CCGGTTTACCCTTAAGCGCTCAAATCTCGAGATTTGAGCGCTTAAGGGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-2169s21c1
Sequence:CCGGACCATGTCTATGATAACATAACTCGAGTTATGTTATCATAGACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-766s21c1
Sequence:CCGGTACCCAGTATTGCACCAATTACTCGAGTAATTGGTGCAATACTGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-541s21c1
Sequence:CCGGGACCTACGTGCAAGATCTAAACTCGAGTTTAGATCTTGCACGTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033253
PLEKHG1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-2667s21c1
Sequence:CCGGATAAGGCTCTGTCCGACAAATCTCGAGATTTGTCGGACAGAGCCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-3961s21c1
Sequence:CCGGTTTACCCTTAAGCGCTCAAATCTCGAGATTTGAGCGCTTAAGGGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-2169s21c1
Sequence:CCGGACCATGTCTATGATAACATAACTCGAGTTATGTTATCATAGACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-766s21c1
Sequence:CCGGTACCCAGTATTGCACCAATTACTCGAGTAATTGGTGCAATACTGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-541s21c1
Sequence:CCGGGACCTACGTGCAAGATCTAAACTCGAGTTTAGATCTTGCACGTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033253
PLEKHG1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-2667s21c1
Sequence:CCGGATAAGGCTCTGTCCGACAAATCTCGAGATTTGTCGGACAGAGCCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-3961s21c1
Sequence:CCGGTTTACCCTTAAGCGCTCAAATCTCGAGATTTGAGCGCTTAAGGGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-2169s21c1
Sequence:CCGGACCATGTCTATGATAACATAACTCGAGTTATGTTATCATAGACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-766s21c1
Sequence:CCGGTACCCAGTATTGCACCAATTACTCGAGTAATTGGTGCAATACTGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033253.2-541s21c1
Sequence:CCGGGACCTACGTGCAAGATCTAAACTCGAGTTTAGATCTTGCACGTAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_027307
PLEKHG1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-4162s1c1
Sequence:CCGGCGGCAACACATTGCATTCTTTCTCGAGAAAGAATGCAATGTGTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-1750s1c1
Sequence:CCGGGCCTAGCAGTTCTACCATGATCTCGAGATCATGGTAGAACTGCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-297s1c1
Sequence:CCGGGCAGCAGAATGACCTTAGTTTCTCGAGAAACTAAGGTCATTCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-3317s1c1
Sequence:CCGGGCTGAGTATTCCCAGTTGTATCTCGAGATACAACTGGGAATACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-1069s1c1
Sequence:CCGGCGCCTGGCATATCAATGACATCTCGAGATGTCATTGATATGCCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_027307
PLEKHG1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-4162s1c1
Sequence:CCGGCGGCAACACATTGCATTCTTTCTCGAGAAAGAATGCAATGTGTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-1750s1c1
Sequence:CCGGGCCTAGCAGTTCTACCATGATCTCGAGATCATGGTAGAACTGCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-297s1c1
Sequence:CCGGGCAGCAGAATGACCTTAGTTTCTCGAGAAACTAAGGTCATTCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-3317s1c1
Sequence:CCGGGCTGAGTATTCCCAGTTGTATCTCGAGATACAACTGGGAATACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-1069s1c1
Sequence:CCGGCGCCTGGCATATCAATGACATCTCGAGATGTCATTGATATGCCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_027307
PLEKHG1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-4162s1c1
Sequence:CCGGCGGCAACACATTGCATTCTTTCTCGAGAAAGAATGCAATGTGTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-1750s1c1
Sequence:CCGGGCCTAGCAGTTCTACCATGATCTCGAGATCATGGTAGAACTGCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-297s1c1
Sequence:CCGGGCAGCAGAATGACCTTAGTTTCTCGAGAAACTAAGGTCATTCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-3317s1c1
Sequence:CCGGGCTGAGTATTCCCAGTTGTATCTCGAGATACAACTGGGAATACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027307.2-1069s1c1
Sequence:CCGGCGCCTGGCATATCAATGACATCTCGAGATGTCATTGATATGCCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)