EMAIL THIS PAGE TO A FRIEND

PLEKHG4

pleckstrin homology domain containing, family G (with RhoGef domain) member 4

70 Gene Product Result for
Synonyms: ARHGEF44 PRTPHN1 SCA4
UniProtKB ID: Q58EX7, Q4G0J8, Q4H485, Q56A69, Q9H7K4, Q9UFW0
Gene ID:
Human(25894) Summary: The protein encoded by this gene contains multiple domains suggestive of a role in intracellular signaling and cytoskeleton dynamics at the Golgi apparatus. Mutations in this gene are associated with spinocerebellar ataxia 16q22-linked. Several alternatively spliced transcript variants, differing only in the 5' UTR, or encoding a different isoform, have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(102075) pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Rat(307796) pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Zebrafish(326099) pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Horse(100065930) pleckstrin homology domain containing, family G (with RhoGef domain) member 4
domestic cat(101089062) pleckstrin homology domain containing, family G (with RhoGef domain) member 4
dog(489759) pleckstrin homology domain containing, family G (with RhoGef domain) member 4
chicken(100859373) pleckstrin homology domain containing, family G (with RhoGef domain) member 4
cow(509753) pleckstrin homology domain containing, family G (with RhoGef domain) member 4
cow(787892) pleckstrin homology domain containing, family G (with RhoGef domain) member 4
sheep(101107985) pleckstrin homology domain containing, family G (with RhoGef domain) member 4
naked mole-rat(101714596) pleckstrin homology domain containing, family G (with RhoGef domain) member 4
domestic guinea pig(100731852) pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081333 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081333 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081333 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015432 Rosetta Predictions human pricing
XM_001075639 Rosetta Predictions rat pricing
XM_226402 Rosetta Predictions rat pricing
NM_001081333 Rosetta Predictions mouse pricing
XM_894892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086500 predicted 5432
2 SASI_Hs02_00347818 predicted 2588
3 SASI_Hs01_00086502 predicted 6092
4 SASI_Hs01_00086504 predicted 3774
5 SASI_Hs01_00086505 predicted 4762
6 SASI_Hs01_00086506 predicted 3861
7 SASI_Hs01_00086507 predicted 3251
8 SASI_Hs01_00086508 predicted 5731
9 SASI_Hs01_00086509 predicted 5035
10 SASI_Hs02_00347819 predicted 5748
11 SASI_Hs01_00086501 predicted 3602
12 SASI_Hs01_00086503 predicted 4153
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350526 predicted 2208
2 SASI_Rn02_00350527 predicted 2482
3 SASI_Rn02_00350528 predicted 1215
4 SASI_Rn02_00350529 predicted 1911
5 SASI_Rn02_00350530 predicted 1903
6 SASI_Rn02_00350531 predicted 211
7 SASI_Rn02_00350532 predicted 1244
8 SASI_Rn02_00350533 predicted 2980
9 SASI_Rn02_00350534 predicted 424
10 SASI_Rn02_00350535 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383513 predicted 2200
2 SASI_Rn02_00383514 predicted 2475
3 SASI_Rn02_00383515 predicted 1216
4 SASI_Rn02_00383516 predicted 1908
5 SASI_Rn02_00383517 predicted 1908
6 SASI_Rn02_00383518 predicted 207
7 SASI_Rn02_00383519 predicted 1252
8 SASI_Rn02_00383520 predicted 2984
9 SASI_Rn02_00383521 predicted 429
10 SASI_Rn02_00383522 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297391 predicted 3584
2 SASI_Mm02_00297392 predicted 2205
3 SASI_Mm02_00297393 predicted 722
4 SASI_Mm02_00297394 predicted 2876
5 SASI_Mm02_00297395 predicted 1219
6 SASI_Mm02_00297396 predicted 3612
7 SASI_Mm02_00297397 predicted 3309
8 SASI_Mm02_00297398 predicted 3529
9 SASI_Mm02_00297399 predicted 3636
10 SASI_Mm02_00297400 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207294 predicted 3582
2 SASI_Mm01_00207295 predicted 2883
3 SASI_Mm01_00207296 predicted 3530
4 SASI_Mm01_00207297 predicted 3620
5 SASI_Mm01_00207298 predicted 3307
6 SASI_Mm01_00207299 predicted 2891
7 SASI_Mm01_00207300 predicted 3634
8 SASI_Mm01_00207301 predicted 2492
9 SASI_Mm01_00207302 predicted 3622
10 SASI_Mm01_00207303 predicted 3176
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015432
PLEKHG4 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-3428s1c1
Sequence:CCGGCCGTCAACTATGTCCTGAAGTCTCGAGACTTCAGGACATAGTTGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-2488s1c1
Sequence:CCGGGAGTACACTATGGAGAACTATCTCGAGATAGTTCTCCATAGTGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-695s1c1
Sequence:CCGGGAGACCCTTTATCAGAAATATCTCGAGATATTTCTGATAAAGGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-3426s1c1
Sequence:CCGGCACCGTCAACTATGTCCTGAACTCGAGTTCAGGACATAGTTGACGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-4091s1c1
Sequence:CCGGGCAGACATTGGGTGTTTCCATCTCGAGATGGAAACACCCAATGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-3928s1c1
Sequence:CCGGCAACGCTGTTGACTACCCTTTCTCGAGAAAGGGTAGTCAACAGCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-2728s1c1
Sequence:CCGGGATGCCCTGATGTCAAGCTATCTCGAGATAGCTTGACATCAGGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015432
PLEKHG4 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-3428s1c1
Sequence:CCGGCCGTCAACTATGTCCTGAAGTCTCGAGACTTCAGGACATAGTTGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-2488s1c1
Sequence:CCGGGAGTACACTATGGAGAACTATCTCGAGATAGTTCTCCATAGTGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-695s1c1
Sequence:CCGGGAGACCCTTTATCAGAAATATCTCGAGATATTTCTGATAAAGGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-3426s1c1
Sequence:CCGGCACCGTCAACTATGTCCTGAACTCGAGTTCAGGACATAGTTGACGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-4091s1c1
Sequence:CCGGGCAGACATTGGGTGTTTCCATCTCGAGATGGAAACACCCAATGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-3928s1c1
Sequence:CCGGCAACGCTGTTGACTACCCTTTCTCGAGAAAGGGTAGTCAACAGCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-2728s1c1
Sequence:CCGGGATGCCCTGATGTCAAGCTATCTCGAGATAGCTTGACATCAGGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015432
PLEKHG4 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-3428s1c1
Sequence:CCGGCCGTCAACTATGTCCTGAAGTCTCGAGACTTCAGGACATAGTTGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-2488s1c1
Sequence:CCGGGAGTACACTATGGAGAACTATCTCGAGATAGTTCTCCATAGTGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-695s1c1
Sequence:CCGGGAGACCCTTTATCAGAAATATCTCGAGATATTTCTGATAAAGGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-3426s1c1
Sequence:CCGGCACCGTCAACTATGTCCTGAACTCGAGTTCAGGACATAGTTGACGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-4091s1c1
Sequence:CCGGGCAGACATTGGGTGTTTCCATCTCGAGATGGAAACACCCAATGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-3928s1c1
Sequence:CCGGCAACGCTGTTGACTACCCTTTCTCGAGAAAGGGTAGTCAACAGCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015432.1-2728s1c1
Sequence:CCGGGATGCCCTGATGTCAAGCTATCTCGAGATAGCTTGACATCAGGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081333
PLEKHG4 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081333.1-1579s21c1
Sequence:CCGGAGATCCCAGCTGACGGAATTTCTCGAGAAATTCCGTCAGCTGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081333.1-3594s21c1
Sequence:CCGGGCCTTTGAATGTGCTATAATCCTCGAGGATTATAGCACATTCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081333.1-1112s21c1
Sequence:CCGGCCCTCATGCAGCAGGTATTAGCTCGAGCTAATACCTGCTGCATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081333.1-1933s21c1
Sequence:CCGGACGAACAACACCGCTACTTTGCTCGAGCAAAGTAGCGGTGTTGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081333.1-3164s21c1
Sequence:CCGGATGACCGCAACATCAACTATGCTCGAGCATAGTTGATGTTGCGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081333
PLEKHG4 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081333.1-1579s21c1
Sequence:CCGGAGATCCCAGCTGACGGAATTTCTCGAGAAATTCCGTCAGCTGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081333.1-3594s21c1
Sequence:CCGGGCCTTTGAATGTGCTATAATCCTCGAGGATTATAGCACATTCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081333.1-1112s21c1
Sequence:CCGGCCCTCATGCAGCAGGTATTAGCTCGAGCTAATACCTGCTGCATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081333.1-1933s21c1
Sequence:CCGGACGAACAACACCGCTACTTTGCTCGAGCAAAGTAGCGGTGTTGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081333.1-3164s21c1
Sequence:CCGGATGACCGCAACATCAACTATGCTCGAGCATAGTTGATGTTGCGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081333
PLEKHG4 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081333.1-1579s21c1
Sequence:CCGGAGATCCCAGCTGACGGAATTTCTCGAGAAATTCCGTCAGCTGGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081333.1-3594s21c1
Sequence:CCGGGCCTTTGAATGTGCTATAATCCTCGAGGATTATAGCACATTCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081333.1-1112s21c1
Sequence:CCGGCCCTCATGCAGCAGGTATTAGCTCGAGCTAATACCTGCTGCATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081333.1-1933s21c1
Sequence:CCGGACGAACAACACCGCTACTTTGCTCGAGCAAAGTAGCGGTGTTGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081333.1-3164s21c1
Sequence:CCGGATGACCGCAACATCAACTATGCTCGAGCATAGTTGATGTTGCGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)