EMAIL THIS PAGE TO A FRIEND

PLEKHG4B

pleckstrin homology domain containing, family G (with RhoGef domain) member 4B

167 Gene Product Result for
UniProtKB ID: Q96PX9
Gene ID:
dog(609578) pleckstrin homology domain containing, family G (with RhoGef domain) member 4B
domestic cat(101083242) pleckstrin homology domain containing, family G (with RhoGef domain) member 4B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052909 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052909 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130891 predicted 3395
2 SASI_Hs01_00130893 predicted 1192
3 SASI_Hs01_00130894 predicted 3402
4 SASI_Hs01_00130895 predicted 2514
5 SASI_Hs01_00130896 predicted 441
6 SASI_Hs01_00130897 predicted 407
7 SASI_Hs01_00130898 predicted 2690
8 SASI_Hs01_00130899 predicted 878
9 SASI_Hs01_00130900 predicted 2516
10 SASI_Hs02_00361665 predicted 895
11 SASI_Hs01_00130892 predicted 953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052909
PLEKHG4B MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family G (with RhoGef domain) member 4B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052909.3-1187s21c1
Sequence:CCGGCCAGGAAGTCGCCGAGTTAATCTCGAGATTAACTCGGCGACTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052909.3-4021s21c1
Sequence:CCGGTTTAGACATTCCCTAACATTTCTCGAGAAATGTTAGGGAATGTCTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-893s1c1
Sequence:CCGGGCCGGGATGAGTTTATCGTTTCTCGAGAAACGATAAACTCATCCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-343s1c1
Sequence:CCGGCGGTGCTTAGGATACGTCATTCTCGAGAATGACGTATCCTAAGCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-1068s1c1
Sequence:CCGGCAGTGGCTTGAGGTTTGAGATCTCGAGATCTCAAACCTCAAGCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-1073s1c1
Sequence:CCGGGCTTGAGGTTTGAGATTTGGTCTCGAGACCAAATCTCAAACCTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052909.1-555s1c1
Sequence:CCGGGATGTACGTGATCTACAGCAACTCGAGTTGCTGTAGATCACGTACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052909.1-549s1c1
Sequence:CCGGGTTTGGGATGTACGTGATCTACTCGAGTAGATCACGTACATCCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-348s1c1
Sequence:CCGGCTTAGGATACGTCATTGACAACTCGAGTTGTCAATGACGTATCCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052909
PLEKHG4B MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family G (with RhoGef domain) member 4B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052909.3-1187s21c1
Sequence:CCGGCCAGGAAGTCGCCGAGTTAATCTCGAGATTAACTCGGCGACTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052909.3-4021s21c1
Sequence:CCGGTTTAGACATTCCCTAACATTTCTCGAGAAATGTTAGGGAATGTCTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-893s1c1
Sequence:CCGGGCCGGGATGAGTTTATCGTTTCTCGAGAAACGATAAACTCATCCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-343s1c1
Sequence:CCGGCGGTGCTTAGGATACGTCATTCTCGAGAATGACGTATCCTAAGCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-1068s1c1
Sequence:CCGGCAGTGGCTTGAGGTTTGAGATCTCGAGATCTCAAACCTCAAGCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-1073s1c1
Sequence:CCGGGCTTGAGGTTTGAGATTTGGTCTCGAGACCAAATCTCAAACCTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052909.1-555s1c1
Sequence:CCGGGATGTACGTGATCTACAGCAACTCGAGTTGCTGTAGATCACGTACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052909.1-549s1c1
Sequence:CCGGGTTTGGGATGTACGTGATCTACTCGAGTAGATCACGTACATCCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-348s1c1
Sequence:CCGGCTTAGGATACGTCATTGACAACTCGAGTTGTCAATGACGTATCCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052909
PLEKHG4B MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family G (with RhoGef domain) member 4B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052909.3-1187s21c1
Sequence:CCGGCCAGGAAGTCGCCGAGTTAATCTCGAGATTAACTCGGCGACTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052909.3-4021s21c1
Sequence:CCGGTTTAGACATTCCCTAACATTTCTCGAGAAATGTTAGGGAATGTCTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-893s1c1
Sequence:CCGGGCCGGGATGAGTTTATCGTTTCTCGAGAAACGATAAACTCATCCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-343s1c1
Sequence:CCGGCGGTGCTTAGGATACGTCATTCTCGAGAATGACGTATCCTAAGCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-1068s1c1
Sequence:CCGGCAGTGGCTTGAGGTTTGAGATCTCGAGATCTCAAACCTCAAGCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-1073s1c1
Sequence:CCGGGCTTGAGGTTTGAGATTTGGTCTCGAGACCAAATCTCAAACCTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052909.1-555s1c1
Sequence:CCGGGATGTACGTGATCTACAGCAACTCGAGTTGCTGTAGATCACGTACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052909.1-549s1c1
Sequence:CCGGGTTTGGGATGTACGTGATCTACTCGAGTAGATCACGTACATCCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052909.1-348s1c1
Sequence:CCGGCTTAGGATACGTCATTGACAACTCGAGTTGTCAATGACGTATCCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)