EMAIL THIS PAGE TO A FRIEND

PLEKHG5

pleckstrin homology domain containing, family G (with RhoGef domain) member 5

93 Gene Product Result for
Synonyms: CMTRIC DSMA4 GEF720 Syx Tech
Gene ID:
Human(57449) Summary: This gene encodes a protein that activates the nuclear factor kappa B (NFKB1) signaling pathway. Mutations in this gene are associated with autosomal recessive distal spinal muscular atrophy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Mouse(269608) pleckstrin homology domain containing, family G (with RhoGef domain) member 5
Rat(310999) pleckstrin homology domain containing, family G (with RhoGef domain) member 5
chicken(426013) pleckstrin homology domain containing, family G (with RhoGef domain) member 5
domestic cat(101094361) pleckstrin homology domain containing, family G (with RhoGef domain) member 5
Horse(100059388) pleckstrin homology domain containing, family G (with RhoGef domain) member 5
dog(479590) pleckstrin homology domain containing, family G (with RhoGef domain) member 5
domestic guinea pig(100733887) pleckstrin homology domain containing, family G (with RhoGef domain) member 5
naked mole-rat(101702499) pleckstrin homology domain containing, family G (with RhoGef domain) member 5
Domestic Rabbit(100350922) pleckstrin homology domain containing, family G (with RhoGef domain) member 5
cow(615910) pleckstrin homology domain containing, family G (with RhoGef domain) member 5
sheep(101121531) pleckstrin homology domain containing, family G (with RhoGef domain) member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020631 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042663 Rosetta Predictions human pricing
NM_001042664 Rosetta Predictions human pricing
NM_001042665 Rosetta Predictions human pricing
NM_020631 Rosetta Predictions human pricing
NM_198681 Rosetta Predictions human pricing
NM_201272 Rosetta Predictions rat pricing
NM_001004156 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310883 predicted 3571
2 SASI_Hs02_00310884 predicted 3559
3 SASI_Hs02_00310885 predicted 3659
4 SASI_Hs02_00310886 predicted 3246
5 SASI_Hs02_00310887 predicted 1228
6 SASI_Hs02_00310888 predicted 2059
7 SASI_Hs02_00310889 predicted 3667
8 SASI_Hs02_00310890 predicted 1825
9 SASI_Hs02_00310891 predicted 3361
10 SASI_Hs02_00310892 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310893 predicted 3521
2 SASI_Hs02_00310894 predicted 3508
3 SASI_Hs02_00310895 predicted 3618
4 SASI_Hs02_00310896 predicted 3203
5 SASI_Hs02_00310897 predicted 1182
6 SASI_Hs02_00310898 predicted 2009
7 SASI_Hs02_00310899 predicted 3619
8 SASI_Hs02_00310900 predicted 1780
9 SASI_Hs02_00310901 predicted 3320
10 SASI_Hs02_00310902 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310903 predicted 3508
2 SASI_Hs02_00310904 predicted 3492
3 SASI_Hs02_00310905 predicted 3599
4 SASI_Hs02_00310906 predicted 3186
5 SASI_Hs02_00310907 predicted 1170
6 SASI_Hs02_00310908 predicted 1996
7 SASI_Hs02_00310909 predicted 3607
8 SASI_Hs02_00310910 predicted 1756
9 SASI_Hs02_00310911 predicted 3302
10 SASI_Hs02_00310912 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166838 predicted 3456
2 SASI_Hs01_00166839 predicted 3439
3 SASI_Hs01_00166840 predicted 3541
4 SASI_Hs01_00166841 predicted 3128
5 SASI_Hs01_00166842 predicted 1111
6 SASI_Hs01_00166843 predicted 1942
7 SASI_Hs01_00166844 predicted 3546
8 SASI_Hs02_00353607 predicted 1704
9 SASI_Hs01_00166845 predicted 3244
10 SASI_Hs01_00166846 predicted 929
11 SASI_Hs01_00166847 predicted 2016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372246 predicted 4029
2 SASI_Hs02_00372247 predicted 4016
3 SASI_Hs02_00372248 predicted 4123
4 SASI_Hs02_00372249 predicted 3710
5 SASI_Hs01_00191148 predicted 1695
6 SASI_Hs01_00191150 predicted 2511
7 SASI_Hs02_00372250 predicted 4126
8 SASI_Hs02_00372251 predicted 2285
9 SASI_Hs02_00372252 predicted 3823
10 SASI_Hs01_00191153 predicted 1512
11 SASI_Hs01_00191146 predicted 1061
12 SASI_Hs01_00191147 predicted 1145
13 SASI_Hs01_00191149 predicted 2536
14 SASI_Hs01_00191151 predicted 1985
15 SASI_Hs01_00191152 predicted 1516
16 SASI_Hs01_00191154 predicted 2586
17 SASI_Hs01_00191155 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201272 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115255 predicted 797
2 SASI_Rn01_00115256 predicted 2050
3 SASI_Rn01_00115257 predicted 3003
4 SASI_Rn01_00115258 predicted 1345
5 SASI_Rn01_00115259 predicted 3348
6 SASI_Rn01_00115260 predicted 859
7 SASI_Rn01_00115261 predicted 1938
8 SASI_Rn01_00115262 predicted 977
9 SASI_Rn01_00115263 predicted 2180
10 SASI_Rn01_00115264 predicted 2336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137799 predicted 1533
2 SASI_Mm01_00137800 predicted 691
3 SASI_Mm01_00137807 predicted 2084
4 SASI_Mm01_00137802 predicted 532
5 SASI_Mm01_00137803 predicted 472
6 SASI_Mm01_00137804 predicted 3058
7 SASI_Mm01_00137805 predicted 1569
8 SASI_Mm01_00137806 predicted 875
9 SASI_Mm02_00286481 predicted 532
10 SASI_Mm01_00137808 predicted 1337
11 SASI_Mm01_00137801 predicted 2079
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020631
PLEKHG5 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family G (with RhoGef domain) member 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020631.3-2097s21c1
Sequence:CCGGTTATCTACCTGAATGAGTTTCCTCGAGGAAACTCATTCAGGTAGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020631.3-645s21c1
Sequence:CCGGAGTCCCTGAGTTTGCCGATTCCTCGAGGAATCGGCAAACTCAGGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-382s1c1
Sequence:CCGGCACTCTGAAATTTGACCTGAACTCGAGTTCAGGTCAAATTTCAGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020631.3-757s21c1
Sequence:CCGGCCGCAAGAACATGTCGGAGTTCTCGAGAACTCCGACATGTTCTTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-470s1c1
Sequence:CCGGGTATTTGAAAGGAAGGGCATTCTCGAGAATGCCCTTCCTTTCAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-1411s1c1
Sequence:CCGGCTTCCTCAAAGGCTTCAAGATCTCGAGATCTTGAAGCCTTTGAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-320s1c1
Sequence:CCGGCTGAAACTCTCCAAGAAGAAACTCGAGTTTCTTCTTGGAGAGTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020631.3-3448s21c1
Sequence:CCGGTAGGCTGCCCATCCTACTTCTCTCGAGAGAAGTAGGATGGGCAGCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-2182s1c1
Sequence:CCGGCACCATTTACAATGCCCAGAACTCGAGTTCTGGGCATTGTAAATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-2621s1c1
Sequence:CCGGCCAACCTCCTTACAAGACTTTCTCGAGAAAGTCTTGTAAGGAGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020631
PLEKHG5 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family G (with RhoGef domain) member 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020631.3-2097s21c1
Sequence:CCGGTTATCTACCTGAATGAGTTTCCTCGAGGAAACTCATTCAGGTAGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020631.3-645s21c1
Sequence:CCGGAGTCCCTGAGTTTGCCGATTCCTCGAGGAATCGGCAAACTCAGGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-382s1c1
Sequence:CCGGCACTCTGAAATTTGACCTGAACTCGAGTTCAGGTCAAATTTCAGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020631.3-757s21c1
Sequence:CCGGCCGCAAGAACATGTCGGAGTTCTCGAGAACTCCGACATGTTCTTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-470s1c1
Sequence:CCGGGTATTTGAAAGGAAGGGCATTCTCGAGAATGCCCTTCCTTTCAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-1411s1c1
Sequence:CCGGCTTCCTCAAAGGCTTCAAGATCTCGAGATCTTGAAGCCTTTGAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-320s1c1
Sequence:CCGGCTGAAACTCTCCAAGAAGAAACTCGAGTTTCTTCTTGGAGAGTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020631.3-3448s21c1
Sequence:CCGGTAGGCTGCCCATCCTACTTCTCTCGAGAGAAGTAGGATGGGCAGCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-2182s1c1
Sequence:CCGGCACCATTTACAATGCCCAGAACTCGAGTTCTGGGCATTGTAAATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-2621s1c1
Sequence:CCGGCCAACCTCCTTACAAGACTTTCTCGAGAAAGTCTTGTAAGGAGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020631
PLEKHG5 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family G (with RhoGef domain) member 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020631.3-2097s21c1
Sequence:CCGGTTATCTACCTGAATGAGTTTCCTCGAGGAAACTCATTCAGGTAGATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020631.3-645s21c1
Sequence:CCGGAGTCCCTGAGTTTGCCGATTCCTCGAGGAATCGGCAAACTCAGGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-382s1c1
Sequence:CCGGCACTCTGAAATTTGACCTGAACTCGAGTTCAGGTCAAATTTCAGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020631.3-757s21c1
Sequence:CCGGCCGCAAGAACATGTCGGAGTTCTCGAGAACTCCGACATGTTCTTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-470s1c1
Sequence:CCGGGTATTTGAAAGGAAGGGCATTCTCGAGAATGCCCTTCCTTTCAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-1411s1c1
Sequence:CCGGCTTCCTCAAAGGCTTCAAGATCTCGAGATCTTGAAGCCTTTGAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-320s1c1
Sequence:CCGGCTGAAACTCTCCAAGAAGAAACTCGAGTTTCTTCTTGGAGAGTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020631.3-3448s21c1
Sequence:CCGGTAGGCTGCCCATCCTACTTCTCTCGAGAGAAGTAGGATGGGCAGCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-2182s1c1
Sequence:CCGGCACCATTTACAATGCCCAGAACTCGAGTTCTGGGCATTGTAAATGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020631.2-2621s1c1
Sequence:CCGGCCAACCTCCTTACAAGACTTTCTCGAGAAAGTCTTGTAAGGAGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004156
PLEKHG5 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family G (with RhoGef domain) member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004156.2-2885s21c1
Sequence:CCGGAGGCTAGCCTCTTACAATTACCTCGAGGTAATTGTAAGAGGCTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004156.2-3786s21c1
Sequence:CCGGCATCACCTCATGGCCAATTTGCTCGAGCAAATTGGCCATGAGGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004156.2-283s21c1
Sequence:CCGGTACGACGGCCATGTCCGATTTCTCGAGAAATCGGACATGGCCGTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004156.2-2298s21c1
Sequence:CCGGGAGCTGGGTGGACACTATTTACTCGAGTAAATAGTGTCCACCCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004156.2-494s21c1
Sequence:CCGGAGGAGTGCTTCACCTTGAAATCTCGAGATTTCAAGGTGAAGCACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004156
PLEKHG5 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family G (with RhoGef domain) member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004156.2-2885s21c1
Sequence:CCGGAGGCTAGCCTCTTACAATTACCTCGAGGTAATTGTAAGAGGCTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004156.2-3786s21c1
Sequence:CCGGCATCACCTCATGGCCAATTTGCTCGAGCAAATTGGCCATGAGGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004156.2-283s21c1
Sequence:CCGGTACGACGGCCATGTCCGATTTCTCGAGAAATCGGACATGGCCGTCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004156.2-2298s21c1
Sequence:CCGGGAGCTGGGTGGACACTATTTACTCGAGTAAATAGTGTCCACCCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004156.2-494s21c1
Sequence:CCGGAGGAGTGCTTCACCTTGAAATCTCGAGATTTCAAGGTGAAGCACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004156
PLEKHG5 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family G (with RhoGef domain) member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004156.2-2885s21c1
Sequence:CCGGAGGCTAGCCTCTTACAATTACCTCGAGGTAATTGTAAGAGGCTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004156.2-3786s21c1
Sequence:CCGGCATCACCTCATGGCCAATTTGCTCGAGCAAATTGGCCATGAGGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004156.2-283s21c1
Sequence:CCGGTACGACGGCCATGTCCGATTTCTCGAGAAATCGGACATGGCCGTCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004156.2-2298s21c1
Sequence:CCGGGAGCTGGGTGGACACTATTTACTCGAGTAAATAGTGTCCACCCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004156.2-494s21c1
Sequence:CCGGAGGAGTGCTTCACCTTGAAATCTCGAGATTTCAAGGTGAAGCACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)