EMAIL THIS PAGE TO A FRIEND

PLEKHG6

pleckstrin homology domain containing, family G (with RhoGef domain) member 6

41 Gene Product Result for
Synonyms: MyoGEF
UniProtKB ID: Q3KR16, Q3SWR1, Q8N1P1, Q8WYY1, Q9H8F4, Q9NVK9
Gene ID:
Mouse(213522) pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Rat(100362241) pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Zebrafish(563725) pleckstrin homology domain containing, family G (with RhoGef domain) member 6
domestic cat(101080898) pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Horse(100051963) pleckstrin homology domain containing, family G (with RhoGef domain) member 6
dog(477717) pleckstrin homology domain containing, family G (with RhoGef domain) member 6
cow(535353) pleckstrin homology domain containing, family G (with RhoGef domain) member 6
sheep(101110410) pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Domestic Rabbit(100356109) pleckstrin homology domain containing, family G (with RhoGef domain) member 6
naked mole-rat(101698614) pleckstrin homology domain containing, family G (with RhoGef domain) member 6
domestic guinea pig(100714171) pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018173 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU058461 MISSION® esiRNA esiRNA targeting mouse Plekhg6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018173 Rosetta Predictions human pricing
NM_198604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148212 predicted 660
2 SASI_Hs01_00148213 predicted 687
3 SASI_Hs01_00148214 predicted 1814
4 SASI_Hs01_00148215 predicted 1423
5 SASI_Hs01_00148216 predicted 1169
6 SASI_Hs01_00148217 predicted 240
7 SASI_Hs01_00148218 predicted 2503
8 SASI_Hs01_00148219 predicted 1475
9 SASI_Hs01_00148220 predicted 557
10 SASI_Hs01_00148221 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072027 predicted 901
2 SASI_Mm01_00072030 predicted 1711
3 SASI_Mm01_00072028 predicted 1157
4 SASI_Mm01_00072032 predicted 2119
5 SASI_Mm02_00351010 predicted 1085
6 SASI_Mm02_00351011 predicted 765
7 SASI_Mm01_00072033 predicted 2790
8 SASI_Mm01_00072035 predicted 1861
9 SASI_Mm01_00072036 predicted 779
10 SASI_Mm02_00351012 predicted 2465
11 SASI_Mm01_00072029 predicted 1096
12 SASI_Mm01_00072031 predicted 1721
13 SASI_Mm01_00072034 predicted 1097
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018173
PLEKHG6 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018173.3-794s21c1
Sequence:CCGGATTCGAACCCACCGGAGCTTTCTCGAGAAAGCTCCGGTGGGTTCGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018173.3-1166s21c1
Sequence:CCGGATTGAAGCCGTGGAGTCATTCCTCGAGGAATGACTCCACGGCTTCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018173.3-2092s21c1
Sequence:CCGGACTGCCGGAAGGAATCCTAAACTCGAGTTTAGGATTCCTTCCGGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018173.3-1299s21c1
Sequence:CCGGAGAAGAACCTGCGCCCATTCTCTCGAGAGAATGGGCGCAGGTTCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018173.1-980s1c1
Sequence:CCGGGCAAGAAACTAACCCTCTCTTCTCGAGAAGAGAGGGTTAGTTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018173.1-1439s1c1
Sequence:CCGGGTTCCTCTTCTCTGATGTGCTCTCGAGAGCACATCAGAGAAGAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018173.1-1049s1c1
Sequence:CCGGGATGCTCTGTGACTTGCTTATCTCGAGATAAGCAAGTCACAGAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018173.1-674s1c1
Sequence:CCGGCTACGTGAGAAAGCTCAAGATCTCGAGATCTTGAGCTTTCTCACGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018173.1-671s1c1
Sequence:CCGGGATCTACGTGAGAAAGCTCAACTCGAGTTGAGCTTTCTCACGTAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018173.1-2716s1c1
Sequence:CCGGCCCACAGAAAGTTGTGCATAACTCGAGTTATGCACAACTTTCTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018173
PLEKHG6 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018173.3-794s21c1
Sequence:CCGGATTCGAACCCACCGGAGCTTTCTCGAGAAAGCTCCGGTGGGTTCGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018173.3-1166s21c1
Sequence:CCGGATTGAAGCCGTGGAGTCATTCCTCGAGGAATGACTCCACGGCTTCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018173.3-2092s21c1
Sequence:CCGGACTGCCGGAAGGAATCCTAAACTCGAGTTTAGGATTCCTTCCGGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018173.3-1299s21c1
Sequence:CCGGAGAAGAACCTGCGCCCATTCTCTCGAGAGAATGGGCGCAGGTTCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018173.1-980s1c1
Sequence:CCGGGCAAGAAACTAACCCTCTCTTCTCGAGAAGAGAGGGTTAGTTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018173.1-1439s1c1
Sequence:CCGGGTTCCTCTTCTCTGATGTGCTCTCGAGAGCACATCAGAGAAGAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018173.1-1049s1c1
Sequence:CCGGGATGCTCTGTGACTTGCTTATCTCGAGATAAGCAAGTCACAGAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018173.1-674s1c1
Sequence:CCGGCTACGTGAGAAAGCTCAAGATCTCGAGATCTTGAGCTTTCTCACGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018173.1-671s1c1
Sequence:CCGGGATCTACGTGAGAAAGCTCAACTCGAGTTGAGCTTTCTCACGTAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018173.1-2716s1c1
Sequence:CCGGCCCACAGAAAGTTGTGCATAACTCGAGTTATGCACAACTTTCTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018173
PLEKHG6 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018173.3-794s21c1
Sequence:CCGGATTCGAACCCACCGGAGCTTTCTCGAGAAAGCTCCGGTGGGTTCGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018173.3-1166s21c1
Sequence:CCGGATTGAAGCCGTGGAGTCATTCCTCGAGGAATGACTCCACGGCTTCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018173.3-2092s21c1
Sequence:CCGGACTGCCGGAAGGAATCCTAAACTCGAGTTTAGGATTCCTTCCGGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018173.3-1299s21c1
Sequence:CCGGAGAAGAACCTGCGCCCATTCTCTCGAGAGAATGGGCGCAGGTTCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018173.1-980s1c1
Sequence:CCGGGCAAGAAACTAACCCTCTCTTCTCGAGAAGAGAGGGTTAGTTTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018173.1-1439s1c1
Sequence:CCGGGTTCCTCTTCTCTGATGTGCTCTCGAGAGCACATCAGAGAAGAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018173.1-1049s1c1
Sequence:CCGGGATGCTCTGTGACTTGCTTATCTCGAGATAAGCAAGTCACAGAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018173.1-674s1c1
Sequence:CCGGCTACGTGAGAAAGCTCAAGATCTCGAGATCTTGAGCTTTCTCACGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018173.1-671s1c1
Sequence:CCGGGATCTACGTGAGAAAGCTCAACTCGAGTTGAGCTTTCTCACGTAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018173.1-2716s1c1
Sequence:CCGGCCCACAGAAAGTTGTGCATAACTCGAGTTATGCACAACTTTCTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198604
PLEKHG6 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198604.1-2843s1c1
Sequence:CCGGCCTAGAGAAATTGTCTCCCTACTCGAGTAGGGAGACAATTTCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198604.1-2793s1c1
Sequence:CCGGCCCTGTCTACATCAGAAGTATCTCGAGATACTTCTGATGTAGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198604.1-1628s1c1
Sequence:CCGGCTGGATCTGATGACTCCTATACTCGAGTATAGGAGTCATCAGATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198604.1-1627s1c1
Sequence:CCGGCCTGGATCTGATGACTCCTATCTCGAGATAGGAGTCATCAGATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198604.1-1243s1c1
Sequence:CCGGCCTTCGAGTAAAGCAGACCATCTCGAGATGGTCTGCTTTACTCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198604
PLEKHG6 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198604.1-2843s1c1
Sequence:CCGGCCTAGAGAAATTGTCTCCCTACTCGAGTAGGGAGACAATTTCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198604.1-2793s1c1
Sequence:CCGGCCCTGTCTACATCAGAAGTATCTCGAGATACTTCTGATGTAGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198604.1-1628s1c1
Sequence:CCGGCTGGATCTGATGACTCCTATACTCGAGTATAGGAGTCATCAGATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198604.1-1627s1c1
Sequence:CCGGCCTGGATCTGATGACTCCTATCTCGAGATAGGAGTCATCAGATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198604.1-1243s1c1
Sequence:CCGGCCTTCGAGTAAAGCAGACCATCTCGAGATGGTCTGCTTTACTCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198604
PLEKHG6 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198604.1-2843s1c1
Sequence:CCGGCCTAGAGAAATTGTCTCCCTACTCGAGTAGGGAGACAATTTCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198604.1-2793s1c1
Sequence:CCGGCCCTGTCTACATCAGAAGTATCTCGAGATACTTCTGATGTAGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198604.1-1628s1c1
Sequence:CCGGCTGGATCTGATGACTCCTATACTCGAGTATAGGAGTCATCAGATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198604.1-1627s1c1
Sequence:CCGGCCTGGATCTGATGACTCCTATCTCGAGATAGGAGTCATCAGATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198604.1-1243s1c1
Sequence:CCGGCCTTCGAGTAAAGCAGACCATCTCGAGATGGTCTGCTTTACTCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)