EMAIL THIS PAGE TO A FRIEND

PLEKHG7

pleckstrin homology domain containing, family G (with RhoGef domain) member 7

21 Gene Product Result for
UniProtKB ID: Q6ZR37, B2RNR7
Gene ID:
domestic guinea pig(100728077) pleckstrin homology domain containing, family G (with RhoGef domain) member 7
naked mole-rat(101722980) pleckstrin homology domain containing, family G (with RhoGef domain) member 7
Domestic Rabbit(100353256) pleckstrin homology domain containing, family G (with RhoGef domain) member 7
cow(519417) pleckstrin homology domain containing, family G (with RhoGef domain) member 7
sheep(101113743) pleckstrin homology domain containing, family G (with RhoGef domain) member 7
Zebrafish(562798) pleckstrin homology domain containing, family G (with RhoGef domain) member 7
Horse(100064291) pleckstrin homology domain containing, family G (with RhoGef domain) member 7
domestic cat(101088502) pleckstrin homology domain containing, family G (with RhoGef domain) member 7
chicken(417895) pleckstrin homology domain containing, family G (with RhoGef domain) member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004330 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131691 MISSION® esiRNA esiRNA human PLEKHG7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004330 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056864 predicted 1152
2 SASI_Hs01_00056865 predicted 1392
3 SASI_Hs01_00056867 predicted 571
4 SASI_Hs01_00056868 predicted 635
5 SASI_Hs02_00304549 predicted 1406
6 SASI_Hs01_00056869 predicted 887
7 SASI_Hs01_00056870 predicted 1353
8 SASI_Hs02_00304550 predicted 882
9 SASI_Hs01_00056872 predicted 1305
10 SASI_Hs02_00304551 predicted 574
11 SASI_Hs01_00056863 predicted 787
12 SASI_Hs01_00056866 predicted 1419
13 SASI_Hs01_00056871 predicted 1228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004330
PLEKHG7 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family G (with RhoGef domain) member 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004330.1-1063s1c1
Sequence:CCGGGCCTATTCCACTAGATAGATTCTCGAGAATCTATCTAGTGGAATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004330.1-2329s1c1
Sequence:CCGGCCATTTCAGAATCGTACCTTTCTCGAGAAAGGTACGATTCTGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004330.1-236s1c1
Sequence:CCGGGATGTGGATTTATGGAGACTTCTCGAGAAGTCTCCATAAATCCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004330.1-2560s1c1
Sequence:CCGGGCACTATTAGAATGGAGACTACTCGAGTAGTCTCCATTCTAATAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004330.1-1181s1c1
Sequence:CCGGGCATTCTTATTACAAGCCCAACTCGAGTTGGGCTTGTAATAAGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004330.1-224s1c1
Sequence:CCGGGAATATCTCCTAGATGTGGATCTCGAGATCCACATCTAGGAGATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004330.1-426s1c1
Sequence:CCGGGCCTGAACTATTCAGCTGCTACTCGAGTAGCAGCTGAATAGTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004330.1-1605s1c1
Sequence:CCGGGCTAATTTGTAAAGGGTGAATCTCGAGATTCACCCTTTACAAATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004330.1-1073s1c1
Sequence:CCGGCTAGATAGATTGGTAGTCAAACTCGAGTTTGACTACCAATCTATCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004330.1-2460s1c1
Sequence:CCGGGCAAGTCATGTGCCCAGTAATCTCGAGATTACTGGGCACATGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004330
PLEKHG7 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family G (with RhoGef domain) member 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004330.1-1063s1c1
Sequence:CCGGGCCTATTCCACTAGATAGATTCTCGAGAATCTATCTAGTGGAATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004330.1-2329s1c1
Sequence:CCGGCCATTTCAGAATCGTACCTTTCTCGAGAAAGGTACGATTCTGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004330.1-236s1c1
Sequence:CCGGGATGTGGATTTATGGAGACTTCTCGAGAAGTCTCCATAAATCCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004330.1-2560s1c1
Sequence:CCGGGCACTATTAGAATGGAGACTACTCGAGTAGTCTCCATTCTAATAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004330.1-1181s1c1
Sequence:CCGGGCATTCTTATTACAAGCCCAACTCGAGTTGGGCTTGTAATAAGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004330.1-224s1c1
Sequence:CCGGGAATATCTCCTAGATGTGGATCTCGAGATCCACATCTAGGAGATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004330.1-426s1c1
Sequence:CCGGGCCTGAACTATTCAGCTGCTACTCGAGTAGCAGCTGAATAGTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004330.1-1605s1c1
Sequence:CCGGGCTAATTTGTAAAGGGTGAATCTCGAGATTCACCCTTTACAAATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004330.1-1073s1c1
Sequence:CCGGCTAGATAGATTGGTAGTCAAACTCGAGTTTGACTACCAATCTATCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004330.1-2460s1c1
Sequence:CCGGGCAAGTCATGTGCCCAGTAATCTCGAGATTACTGGGCACATGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004330
PLEKHG7 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family G (with RhoGef domain) member 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004330.1-1063s1c1
Sequence:CCGGGCCTATTCCACTAGATAGATTCTCGAGAATCTATCTAGTGGAATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004330.1-2329s1c1
Sequence:CCGGCCATTTCAGAATCGTACCTTTCTCGAGAAAGGTACGATTCTGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004330.1-236s1c1
Sequence:CCGGGATGTGGATTTATGGAGACTTCTCGAGAAGTCTCCATAAATCCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004330.1-2560s1c1
Sequence:CCGGGCACTATTAGAATGGAGACTACTCGAGTAGTCTCCATTCTAATAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004330.1-1181s1c1
Sequence:CCGGGCATTCTTATTACAAGCCCAACTCGAGTTGGGCTTGTAATAAGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004330.1-224s1c1
Sequence:CCGGGAATATCTCCTAGATGTGGATCTCGAGATCCACATCTAGGAGATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004330.1-426s1c1
Sequence:CCGGGCCTGAACTATTCAGCTGCTACTCGAGTAGCAGCTGAATAGTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004330.1-1605s1c1
Sequence:CCGGGCTAATTTGTAAAGGGTGAATCTCGAGATTCACCCTTTACAAATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004330.1-1073s1c1
Sequence:CCGGCTAGATAGATTGGTAGTCAAACTCGAGTTTGACTACCAATCTATCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004330.1-2460s1c1
Sequence:CCGGGCAAGTCATGTGCCCAGTAATCTCGAGATTACTGGGCACATGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)