EMAIL THIS PAGE TO A FRIEND

PLEKHH1

pleckstrin homology domain containing, family H (with MyTH4 domain) member 1

166 Gene Product Result for
UniProtKB ID: Q9ULM0, A6H8X6, Q6PJL4, Q6ZWC7
Gene ID:
Mouse(211945) pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Rat(314262) pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Zebrafish(565914) pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Horse(100052819) pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
domestic cat(101092191) pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
dog(480363) pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
chicken(423270) pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
cow(515305) pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
sheep(101121427) pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Domestic Rabbit(100354469) pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
naked mole-rat(101717797) pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
domestic guinea pig(100717200) pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020715 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_126961 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_126961 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_126961 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020715 Rosetta Predictions human pricing
NM_001108036 Rosetta Predictions rat pricing
XM_126961 Rosetta Predictions mouse pricing
XM_904513 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061130 predicted 1445
2 SASI_Hs01_00061131 predicted 2549
3 SASI_Hs01_00061132 predicted 1584
4 SASI_Hs01_00061133 predicted 651
5 SASI_Hs01_00061134 predicted 414
6 SASI_Hs01_00061135 predicted 2818
7 SASI_Hs01_00061136 predicted 4283
8 SASI_Hs01_00061138 predicted 540
9 SASI_Hs02_00353731 predicted 419
10 SASI_Hs02_00353732 predicted 1955
11 SASI_Hs01_00061137 predicted 3297
12 SASI_Hs01_00061139 predicted 4244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234725 predicted 3622
2 SASI_Rn02_00234726 predicted 3479
3 SASI_Rn02_00234727 predicted 3557
4 SASI_Rn02_00234728 predicted 3562
5 SASI_Rn02_00234729 predicted 3756
6 SASI_Rn02_00234730 predicted 2948
7 SASI_Rn02_00234731 predicted 1122
8 SASI_Rn02_00234732 predicted 3401
9 SASI_Rn02_00234733 predicted 3235
10 SASI_Rn02_00234734 predicted 3842
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424178 predicted 1308
2 SASI_Mm01_00217796 predicted 1912
3 SASI_Mm01_00217797 predicted 4745
4 SASI_Mm01_00217799 predicted 3271
5 SASI_Mm01_00217800 predicted 4383
6 SASI_Mm01_00217801 predicted 4531
7 SASI_Mm01_00217802 predicted 3766
8 SASI_Mm02_00424179 predicted 4386
9 SASI_Mm01_00217803 predicted 4485
10 SASI_Mm01_00217804 predicted 2295
11 SASI_Mm01_00217798 predicted 4591
12 SASI_Mm01_00217805 predicted 1486
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430943 predicted 1301
2 SASI_Mm02_00430944 predicted 1905
3 SASI_Mm02_00430945 predicted 4746
4 SASI_Mm02_00430946 predicted 3270
5 SASI_Mm02_00430947 predicted 4377
6 SASI_Mm02_00430948 predicted 4536
7 SASI_Mm02_00430949 predicted 3762
8 SASI_Mm02_00430950 predicted 4384
9 SASI_Mm02_00430951 predicted 4486
10 SASI_Mm02_00430952 predicted 2294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020715
PLEKHH1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020715.1-2318s1c1
Sequence:CCGGGCGCACATAGAGGAAGTAGATCTCGAGATCTACTTCCTCTATGTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020715.1-3959s1c1
Sequence:CCGGGATGACTTCATGCTTGTGATTCTCGAGAATCACAAGCATGAAGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020715.1-5248s1c1
Sequence:CCGGGCCATCATTTGTTTCCTTCTTCTCGAGAAGAAGGAAACAAATGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020715.1-4077s1c1
Sequence:CCGGCCAGCTATATGAACCATTGCACTCGAGTGCAATGGTTCATATAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020715.1-5088s1c1
Sequence:CCGGCCTGCTAAGATTCAAGCTGTTCTCGAGAACAGCTTGAATCTTAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020715.2-4309s21c1
Sequence:CCGGTACTACTGTGACGGGTCTAACCTCGAGGTTAGACCCGTCACAGTAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020715.2-4489s21c1
Sequence:CCGGGCTACCTGATTCTAGACATAGCTCGAGCTATGTCTAGAATCAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020715.2-4531s21c1
Sequence:CCGGTGAGGGCATCAGTGCTATAAGCTCGAGCTTATAGCACTGATGCCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020715.2-4224s21c1
Sequence:CCGGCAACGTTGCTGTGAATATTTCCTCGAGGAAATATTCACAGCAACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020715
PLEKHH1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020715.1-2318s1c1
Sequence:CCGGGCGCACATAGAGGAAGTAGATCTCGAGATCTACTTCCTCTATGTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020715.1-3959s1c1
Sequence:CCGGGATGACTTCATGCTTGTGATTCTCGAGAATCACAAGCATGAAGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020715.1-5248s1c1
Sequence:CCGGGCCATCATTTGTTTCCTTCTTCTCGAGAAGAAGGAAACAAATGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020715.1-4077s1c1
Sequence:CCGGCCAGCTATATGAACCATTGCACTCGAGTGCAATGGTTCATATAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020715.1-5088s1c1
Sequence:CCGGCCTGCTAAGATTCAAGCTGTTCTCGAGAACAGCTTGAATCTTAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020715.2-4309s21c1
Sequence:CCGGTACTACTGTGACGGGTCTAACCTCGAGGTTAGACCCGTCACAGTAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020715.2-4489s21c1
Sequence:CCGGGCTACCTGATTCTAGACATAGCTCGAGCTATGTCTAGAATCAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020715.2-4531s21c1
Sequence:CCGGTGAGGGCATCAGTGCTATAAGCTCGAGCTTATAGCACTGATGCCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020715.2-4224s21c1
Sequence:CCGGCAACGTTGCTGTGAATATTTCCTCGAGGAAATATTCACAGCAACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020715
PLEKHH1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020715.1-2318s1c1
Sequence:CCGGGCGCACATAGAGGAAGTAGATCTCGAGATCTACTTCCTCTATGTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020715.1-3959s1c1
Sequence:CCGGGATGACTTCATGCTTGTGATTCTCGAGAATCACAAGCATGAAGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020715.1-5248s1c1
Sequence:CCGGGCCATCATTTGTTTCCTTCTTCTCGAGAAGAAGGAAACAAATGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020715.1-4077s1c1
Sequence:CCGGCCAGCTATATGAACCATTGCACTCGAGTGCAATGGTTCATATAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020715.1-5088s1c1
Sequence:CCGGCCTGCTAAGATTCAAGCTGTTCTCGAGAACAGCTTGAATCTTAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020715.2-4309s21c1
Sequence:CCGGTACTACTGTGACGGGTCTAACCTCGAGGTTAGACCCGTCACAGTAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020715.2-4489s21c1
Sequence:CCGGGCTACCTGATTCTAGACATAGCTCGAGCTATGTCTAGAATCAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020715.2-4531s21c1
Sequence:CCGGTGAGGGCATCAGTGCTATAAGCTCGAGCTTATAGCACTGATGCCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020715.2-4224s21c1
Sequence:CCGGCAACGTTGCTGTGAATATTTCCTCGAGGAAATATTCACAGCAACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_126961
PLEKHH1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126961.5-5725s1c1
Sequence:CCGGCCCAACAATGTGTGTGTTGTACTCGAGTACAACACACACATTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126961.5-442s1c1
Sequence:CCGGCGGGAGTATTTGGAAGTTGGTCTCGAGACCAACTTCCAAATACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126961.5-2859s1c1
Sequence:CCGGCACTGTCTATGAGCAGCTCATCTCGAGATGAGCTGCTCATAGACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126961.5-3249s1c1
Sequence:CCGGCCACTTCCTCTGGTATGTCAACTCGAGTTGACATACCAGAGGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126961.5-4344s1c1
Sequence:CCGGCCGTATTGACAAGTTGACCTTCTCGAGAAGGTCAACTTGTCAATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_126961
PLEKHH1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126961.5-5725s1c1
Sequence:CCGGCCCAACAATGTGTGTGTTGTACTCGAGTACAACACACACATTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126961.5-442s1c1
Sequence:CCGGCGGGAGTATTTGGAAGTTGGTCTCGAGACCAACTTCCAAATACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126961.5-2859s1c1
Sequence:CCGGCACTGTCTATGAGCAGCTCATCTCGAGATGAGCTGCTCATAGACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126961.5-3249s1c1
Sequence:CCGGCCACTTCCTCTGGTATGTCAACTCGAGTTGACATACCAGAGGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126961.5-4344s1c1
Sequence:CCGGCCGTATTGACAAGTTGACCTTCTCGAGAAGGTCAACTTGTCAATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_126961
PLEKHH1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126961.5-5725s1c1
Sequence:CCGGCCCAACAATGTGTGTGTTGTACTCGAGTACAACACACACATTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126961.5-442s1c1
Sequence:CCGGCGGGAGTATTTGGAAGTTGGTCTCGAGACCAACTTCCAAATACTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126961.5-2859s1c1
Sequence:CCGGCACTGTCTATGAGCAGCTCATCTCGAGATGAGCTGCTCATAGACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126961.5-3249s1c1
Sequence:CCGGCCACTTCCTCTGGTATGTCAACTCGAGTTGACATACCAGAGGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126961.5-4344s1c1
Sequence:CCGGCCGTATTGACAAGTTGACCTTCTCGAGAAGGTCAACTTGTCAATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)