EMAIL THIS PAGE TO A FRIEND

PLEKHH2

pleckstrin homology domain containing, family H (with MyTH4 domain) member 2

190 Gene Product Result for
Synonyms: PLEKHH1L
UniProtKB ID: Q8IVE3, Q5JPJ6, Q6P4Q1, Q8N3Q3
Gene ID:
Mouse(213556) pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Rat(313866) pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
domestic guinea pig(100725042) pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
naked mole-rat(101719790) pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Domestic Rabbit(100357558) pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
cow(100299044) pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
sheep(101114431) pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Zebrafish(568304) pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
dog(481353) pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Horse(100053639) pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
domestic cat(101098785) pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
chicken(421399) pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172069 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172069 Rosetta Predictions human pricing
XM_233830 Rosetta Predictions rat pricing
NM_177606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367790 predicted 3412
2 SASI_Hs01_00207221 predicted 2598
3 SASI_Hs01_00207222 predicted 1741
4 SASI_Hs01_00207223 predicted 2713
5 SASI_Hs01_00207225 predicted 1451
6 SASI_Hs01_00207226 predicted 1477
7 SASI_Hs01_00207227 predicted 3315
8 SASI_Hs01_00207228 predicted 4244
9 SASI_Hs01_00207229 predicted 841
10 SASI_Hs01_00207230 predicted 3464
11 SASI_Hs01_00207224 predicted 2634
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233830 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388080 predicted 4041
2 SASI_Rn02_00388081 predicted 4064
3 SASI_Rn02_00388082 predicted 4036
4 SASI_Rn02_00388083 predicted 4067
5 SASI_Rn02_00388084 predicted 4109
6 SASI_Rn02_00388085 predicted 4238
7 SASI_Rn02_00388086 predicted 4210
8 SASI_Rn02_00388087 predicted 4139
9 SASI_Rn02_00388088 predicted 4148
10 SASI_Rn02_00388089 predicted 4184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347810 predicted 3312
2 SASI_Mm02_00347811 predicted 626
3 SASI_Mm02_00347812 predicted 4292
4 SASI_Mm02_00347813 predicted 3285
5 SASI_Mm02_00347814 predicted 2597
6 SASI_Mm02_00347815 predicted 2700
7 SASI_Mm02_00347816 predicted 1445
8 SASI_Mm02_00347817 predicted 4284
9 SASI_Mm02_00347818 predicted 471
10 SASI_Mm02_00347819 predicted 4244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172069
VALIDATED
PLEKHH2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-4231s21c1
Sequence:CCGGACAACTCCATGAGGTTAATAGCTCGAGCTATTAACCTCATGGAGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_172069.1-4396s1c1
Sequence:CCGGCGCCAGTTACATAAACAACTTCTCGAGAAGTTGTTTATGTAACTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-1598s21c1
Sequence:CCGGGAGTTGTGATGATGGATTATTCTCGAGAATAATCCATCATCACAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-317s21c1
Sequence:CCGGTGAATCAGAGACAAGATTATACTCGAGTATAATCTTGTCTCTGATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_172069.1-1776s1c1
Sequence:CCGGCCTTCAATATGGAGAGTGTTACTCGAGTAACACTCTCCATATTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172069.1-2316s1c1
Sequence:CCGGGCCATATTGAACTTAGTGCATCTCGAGATGCACTAAGTTCAATATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172069.1-1313s1c1
Sequence:CCGGCCAGCTTTAATGCCAAAGCATCTCGAGATGCTTTGGCATTAAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172069.1-167s1c1
Sequence:CCGGGCAAGCAAGATACGAGAGCTTCTCGAGAAGCTCTCGTATCTTGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-3459s21c1
Sequence:CCGGCACTTCATGAATGGGATATACCTCGAGGTATATCCCATTCATGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-2433s21c1
Sequence:CCGGATATTGGAAGAGTGGATTAAACTCGAGTTTAATCCACTCTTCCAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-348s21c1
Sequence:CCGGCAAGATCTGGAGTCGCTAATACTCGAGTATTAGCGACTCCAGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172069
VALIDATED
PLEKHH2 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-4231s21c1
Sequence:CCGGACAACTCCATGAGGTTAATAGCTCGAGCTATTAACCTCATGGAGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_172069.1-4396s1c1
Sequence:CCGGCGCCAGTTACATAAACAACTTCTCGAGAAGTTGTTTATGTAACTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-1598s21c1
Sequence:CCGGGAGTTGTGATGATGGATTATTCTCGAGAATAATCCATCATCACAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-317s21c1
Sequence:CCGGTGAATCAGAGACAAGATTATACTCGAGTATAATCTTGTCTCTGATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_172069.1-1776s1c1
Sequence:CCGGCCTTCAATATGGAGAGTGTTACTCGAGTAACACTCTCCATATTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172069.1-2316s1c1
Sequence:CCGGGCCATATTGAACTTAGTGCATCTCGAGATGCACTAAGTTCAATATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172069.1-1313s1c1
Sequence:CCGGCCAGCTTTAATGCCAAAGCATCTCGAGATGCTTTGGCATTAAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172069.1-167s1c1
Sequence:CCGGGCAAGCAAGATACGAGAGCTTCTCGAGAAGCTCTCGTATCTTGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-3459s21c1
Sequence:CCGGCACTTCATGAATGGGATATACCTCGAGGTATATCCCATTCATGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-2433s21c1
Sequence:CCGGATATTGGAAGAGTGGATTAAACTCGAGTTTAATCCACTCTTCCAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-348s21c1
Sequence:CCGGCAAGATCTGGAGTCGCTAATACTCGAGTATTAGCGACTCCAGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172069
VALIDATED
PLEKHH2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-4231s21c1
Sequence:CCGGACAACTCCATGAGGTTAATAGCTCGAGCTATTAACCTCATGGAGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_172069.1-4396s1c1
Sequence:CCGGCGCCAGTTACATAAACAACTTCTCGAGAAGTTGTTTATGTAACTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-1598s21c1
Sequence:CCGGGAGTTGTGATGATGGATTATTCTCGAGAATAATCCATCATCACAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-317s21c1
Sequence:CCGGTGAATCAGAGACAAGATTATACTCGAGTATAATCTTGTCTCTGATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_172069.1-1776s1c1
Sequence:CCGGCCTTCAATATGGAGAGTGTTACTCGAGTAACACTCTCCATATTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172069.1-2316s1c1
Sequence:CCGGGCCATATTGAACTTAGTGCATCTCGAGATGCACTAAGTTCAATATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172069.1-1313s1c1
Sequence:CCGGCCAGCTTTAATGCCAAAGCATCTCGAGATGCTTTGGCATTAAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172069.1-167s1c1
Sequence:CCGGGCAAGCAAGATACGAGAGCTTCTCGAGAAGCTCTCGTATCTTGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-3459s21c1
Sequence:CCGGCACTTCATGAATGGGATATACCTCGAGGTATATCCCATTCATGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-2433s21c1
Sequence:CCGGATATTGGAAGAGTGGATTAAACTCGAGTTTAATCCACTCTTCCAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172069.3-348s21c1
Sequence:CCGGCAAGATCTGGAGTCGCTAATACTCGAGTATTAGCGACTCCAGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177606
PLEKHH2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177606.2-2316s1c1
Sequence:CCGGGCCACATTGAACTGAGTGCATCTCGAGATGCACTCAGTTCAATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177606.2-2998s1c1
Sequence:CCGGCGAGGCCATTAAGCTATTTAACTCGAGTTAAATAGCTTAATGGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177606.2-1836s1c1
Sequence:CCGGGCCTTTATACGTCTCTCATATCTCGAGATATGAGAGACGTATAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177606.2-5886s1c1
Sequence:CCGGCGTCTACCTAACTTCTATTTACTCGAGTAAATAGAAGTTAGGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177606.2-461s1c1
Sequence:CCGGGCTAAGATCAAAGAATGGGTACTCGAGTACCCATTCTTTGATCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177606
PLEKHH2 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177606.2-2316s1c1
Sequence:CCGGGCCACATTGAACTGAGTGCATCTCGAGATGCACTCAGTTCAATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177606.2-2998s1c1
Sequence:CCGGCGAGGCCATTAAGCTATTTAACTCGAGTTAAATAGCTTAATGGCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177606.2-1836s1c1
Sequence:CCGGGCCTTTATACGTCTCTCATATCTCGAGATATGAGAGACGTATAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177606.2-5886s1c1
Sequence:CCGGCGTCTACCTAACTTCTATTTACTCGAGTAAATAGAAGTTAGGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177606.2-461s1c1
Sequence:CCGGGCTAAGATCAAAGAATGGGTACTCGAGTACCCATTCTTTGATCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177606
PLEKHH2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177606.2-2316s1c1
Sequence:CCGGGCCACATTGAACTGAGTGCATCTCGAGATGCACTCAGTTCAATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177606.2-2998s1c1
Sequence:CCGGCGAGGCCATTAAGCTATTTAACTCGAGTTAAATAGCTTAATGGCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177606.2-1836s1c1
Sequence:CCGGGCCTTTATACGTCTCTCATATCTCGAGATATGAGAGACGTATAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177606.2-5886s1c1
Sequence:CCGGCGTCTACCTAACTTCTATTTACTCGAGTAAATAGAAGTTAGGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177606.2-461s1c1
Sequence:CCGGGCTAAGATCAAAGAATGGGTACTCGAGTACCCATTCTTTGATCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)