EMAIL THIS PAGE TO A FRIEND

PLEKHM1

pleckstrin homology domain containing, family M (with RUN domain) member 1

54 Gene Product Result for
Synonyms: AP162 B2 OPTB6
UniProtKB ID: Q9Y4G2, Q6P2R5, Q8TEL9, Q9NPP5, Q9NYA0
Gene ID:
Human(9842) Summary: The protein encoded by this gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. Mutations in this gene are associated with autosomal recessive osteopetrosis type 6 (OPTB6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(353047) pleckstrin homology domain containing, family M (with RUN domain) member 1
Rat(303584) pleckstrin homology domain containing, family M (with RUN domain) member 1
Zebrafish(564048) pleckstrin homology domain containing, family M (with RUN domain) member 1
Horse(100050008) pleckstrin homology domain containing, family M (with RUN domain) member 1
domestic cat(101087796) pleckstrin homology domain containing, family M (with RUN domain) member 1
dog(490925) pleckstrin homology domain containing, family M (with RUN domain) member 1
chicken(419939) pleckstrin homology domain containing, family M (with RUN domain) member 1
cow(523424) pleckstrin homology domain containing, family M (with RUN domain) member 1
sheep(101119061) pleckstrin homology domain containing, family M (with RUN domain) member 1
naked mole-rat(101701904) pleckstrin homology domain containing, family M (with RUN domain) member 1
Domestic Rabbit(100338936) pleckstrin homology domain containing, family M (with RUN domain) member 1
domestic guinea pig(100719025) pleckstrin homology domain containing, family M (with RUN domain) member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183034 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183034 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183034 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014798 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014798 Rosetta Predictions human pricing
NM_001009677 Rosetta Predictions rat pricing
NM_183034 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130361 predicted 1057
2 SASI_Hs01_00130363 predicted 1283
3 SASI_Hs01_00130364 predicted 1074
4 SASI_Hs01_00130365 predicted 663
5 SASI_Hs01_00130366 predicted 1051
6 SASI_Hs01_00130367 predicted 3004
7 SASI_Hs01_00130368 predicted 1897
8 SASI_Hs01_00130369 predicted 299
9 SASI_Hs02_00346303 predicted 1412
10 SASI_Hs02_00346304 predicted 2978
11 SASI_Hs01_00130362 predicted 674
12 SASI_Hs01_00130370 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044788 predicted 2256
2 SASI_Rn01_00044790 predicted 2195
3 SASI_Rn01_00044791 predicted 1353
4 SASI_Rn01_00044792 predicted 622
5 SASI_Rn01_00044793 predicted 2428
6 SASI_Rn01_00044794 predicted 594
7 SASI_Rn01_00044795 predicted 1375
8 SASI_Rn02_00199715 predicted 2109
9 SASI_Rn01_00044796 predicted 310
10 SASI_Rn01_00044797 predicted 1172
11 SASI_Rn01_00044789 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181137 predicted 2323
2 SASI_Mm01_00181138 predicted 1188
3 SASI_Mm01_00181139 predicted 3375
4 SASI_Mm01_00181140 predicted 2668
5 SASI_Mm01_00181141 predicted 2316
6 SASI_Mm01_00181142 predicted 3073
7 SASI_Mm01_00181143 predicted 2054
8 SASI_Mm01_00181144 predicted 639
9 SASI_Mm01_00181145 predicted 2758
10 SASI_Mm01_00181146 predicted 1397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183034
VALIDATED
PLEKHM1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family M (with RUN domain) member 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183034.1-892s21c1
Sequence:CCGGAGCTGTCCTGCAGCCTAAATTCTCGAGAATTTAGGCTGCAGGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183034.1-2570s1c1
Sequence:CCGGGAAGTTTGCTACCAGGGAGAACTCGAGTTCTCCCTGGTAGCAAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183034.1-812s1c1
Sequence:CCGGCCAACACTCAGGCCATAAGATCTCGAGATCTTATGGCCTGAGTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183034.1-538s21c1
Sequence:CCGGCACGGTTGTGCGAGTACTATCCTCGAGGATAGTACTCGCACAACCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183034.1-3976s21c1
Sequence:CCGGGAGCTCTTGGCTTACCTAATACTCGAGTATTAGGTAAGCCAAGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183034.1-2206s21c1
Sequence:CCGGCAGAACCAGATGCTATCAAAGCTCGAGCTTTGATAGCATCTGGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183034.1-1048s21c1
Sequence:CCGGTCAGCAAAGCCCAGGTAAATTCTCGAGAATTTACCTGGGCTTTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183034.1-2214s1c1
Sequence:CCGGGATGCTATCAAAGAGTCCCTTCTCGAGAAGGGACTCTTTGATAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183034
VALIDATED
PLEKHM1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family M (with RUN domain) member 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183034.1-892s21c1
Sequence:CCGGAGCTGTCCTGCAGCCTAAATTCTCGAGAATTTAGGCTGCAGGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183034.1-2570s1c1
Sequence:CCGGGAAGTTTGCTACCAGGGAGAACTCGAGTTCTCCCTGGTAGCAAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183034.1-812s1c1
Sequence:CCGGCCAACACTCAGGCCATAAGATCTCGAGATCTTATGGCCTGAGTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183034.1-538s21c1
Sequence:CCGGCACGGTTGTGCGAGTACTATCCTCGAGGATAGTACTCGCACAACCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183034.1-3976s21c1
Sequence:CCGGGAGCTCTTGGCTTACCTAATACTCGAGTATTAGGTAAGCCAAGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183034.1-2206s21c1
Sequence:CCGGCAGAACCAGATGCTATCAAAGCTCGAGCTTTGATAGCATCTGGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183034.1-1048s21c1
Sequence:CCGGTCAGCAAAGCCCAGGTAAATTCTCGAGAATTTACCTGGGCTTTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183034.1-2214s1c1
Sequence:CCGGGATGCTATCAAAGAGTCCCTTCTCGAGAAGGGACTCTTTGATAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183034
VALIDATED
PLEKHM1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family M (with RUN domain) member 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183034.1-892s21c1
Sequence:CCGGAGCTGTCCTGCAGCCTAAATTCTCGAGAATTTAGGCTGCAGGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183034.1-2570s1c1
Sequence:CCGGGAAGTTTGCTACCAGGGAGAACTCGAGTTCTCCCTGGTAGCAAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183034.1-812s1c1
Sequence:CCGGCCAACACTCAGGCCATAAGATCTCGAGATCTTATGGCCTGAGTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183034.1-538s21c1
Sequence:CCGGCACGGTTGTGCGAGTACTATCCTCGAGGATAGTACTCGCACAACCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183034.1-3976s21c1
Sequence:CCGGGAGCTCTTGGCTTACCTAATACTCGAGTATTAGGTAAGCCAAGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183034.1-2206s21c1
Sequence:CCGGCAGAACCAGATGCTATCAAAGCTCGAGCTTTGATAGCATCTGGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183034.1-1048s21c1
Sequence:CCGGTCAGCAAAGCCCAGGTAAATTCTCGAGAATTTACCTGGGCTTTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183034.1-2214s1c1
Sequence:CCGGGATGCTATCAAAGAGTCCCTTCTCGAGAAGGGACTCTTTGATAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014798
VALIDATED
PLEKHM1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family M (with RUN domain) member 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.2-706s21c1
Sequence:CCGGCCTACAAGTCTGCCATCTTAACTCGAGTTAAGATGGCAGACTTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-2792s1c1
Sequence:CCGGCCTGAAGTTTCTGACACAGATCTCGAGATCTGTGTCAGAAACTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014798.1-5057s1c1
Sequence:CCGGGCCAGTGCTTTCAGATGCATTCTCGAGAATGCATCTGAAAGCACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.1-2276s21c1
Sequence:CCGGCATCAGGAACAATGAGAAGATCTCGAGATCTTCTCATTGTTCCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.1-2679s21c1
Sequence:CCGGGCCTTCTCTGGCCTCTATTACCTCGAGGTAATAGAGGCCAGAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.2-1442s21c1
Sequence:CCGGTGGTCTGAAGCTGGTAGTTTCCTCGAGGAAACTACCAGCTTCAGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014798.2-3783s21c1
Sequence:CCGGTACGTGAGTCACCCATGAAATCTCGAGATTTCATGGGTGACTCACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-428s1c1
Sequence:CCGGCAAACACATCATCTCAGAGTTCTCGAGAACTCTGAGATGATGTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-5103s1c1
Sequence:CCGGGAAAGGTAGTGCCCACACTATCTCGAGATAGTGTGGGCACTACCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.2-2309s21c1
Sequence:CCGGCCGCATCAGGAACAATGAGAACTCGAGTTCTCATTGTTCCTGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.1-2220s21c1
Sequence:CCGGAGGACCTGGATGCCCTATATACTCGAGTATATAGGGCATCCAGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014798.1-929s1c1
Sequence:CCGGCCTAAACTCTGATAGCTGCTTCTCGAGAAGCAGCTATCAGAGTTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-2276s1c1
Sequence:CCGGCATCAGGAACAATGAGAAGATCTCGAGATCTTCTCATTGTTCCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-2273s1c1
Sequence:CCGGCCGCATCAGGAACAATGAGAACTCGAGTTCTCATTGTTCCTGATGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.2-1079s21c1
Sequence:CCGGCCGGTCTCTGCAAGAGGTATTCTCGAGAATACCTCTTGCAGAGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014798
VALIDATED
PLEKHM1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family M (with RUN domain) member 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.2-706s21c1
Sequence:CCGGCCTACAAGTCTGCCATCTTAACTCGAGTTAAGATGGCAGACTTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-2792s1c1
Sequence:CCGGCCTGAAGTTTCTGACACAGATCTCGAGATCTGTGTCAGAAACTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014798.1-5057s1c1
Sequence:CCGGGCCAGTGCTTTCAGATGCATTCTCGAGAATGCATCTGAAAGCACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.1-2276s21c1
Sequence:CCGGCATCAGGAACAATGAGAAGATCTCGAGATCTTCTCATTGTTCCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.1-2679s21c1
Sequence:CCGGGCCTTCTCTGGCCTCTATTACCTCGAGGTAATAGAGGCCAGAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.2-1442s21c1
Sequence:CCGGTGGTCTGAAGCTGGTAGTTTCCTCGAGGAAACTACCAGCTTCAGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014798.2-3783s21c1
Sequence:CCGGTACGTGAGTCACCCATGAAATCTCGAGATTTCATGGGTGACTCACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-428s1c1
Sequence:CCGGCAAACACATCATCTCAGAGTTCTCGAGAACTCTGAGATGATGTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-5103s1c1
Sequence:CCGGGAAAGGTAGTGCCCACACTATCTCGAGATAGTGTGGGCACTACCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.2-2309s21c1
Sequence:CCGGCCGCATCAGGAACAATGAGAACTCGAGTTCTCATTGTTCCTGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.1-2220s21c1
Sequence:CCGGAGGACCTGGATGCCCTATATACTCGAGTATATAGGGCATCCAGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014798.1-929s1c1
Sequence:CCGGCCTAAACTCTGATAGCTGCTTCTCGAGAAGCAGCTATCAGAGTTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-2276s1c1
Sequence:CCGGCATCAGGAACAATGAGAAGATCTCGAGATCTTCTCATTGTTCCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-2273s1c1
Sequence:CCGGCCGCATCAGGAACAATGAGAACTCGAGTTCTCATTGTTCCTGATGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.2-1079s21c1
Sequence:CCGGCCGGTCTCTGCAAGAGGTATTCTCGAGAATACCTCTTGCAGAGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014798
VALIDATED
PLEKHM1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family M (with RUN domain) member 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.2-706s21c1
Sequence:CCGGCCTACAAGTCTGCCATCTTAACTCGAGTTAAGATGGCAGACTTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-2792s1c1
Sequence:CCGGCCTGAAGTTTCTGACACAGATCTCGAGATCTGTGTCAGAAACTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014798.1-5057s1c1
Sequence:CCGGGCCAGTGCTTTCAGATGCATTCTCGAGAATGCATCTGAAAGCACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.1-2276s21c1
Sequence:CCGGCATCAGGAACAATGAGAAGATCTCGAGATCTTCTCATTGTTCCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.1-2679s21c1
Sequence:CCGGGCCTTCTCTGGCCTCTATTACCTCGAGGTAATAGAGGCCAGAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.2-1442s21c1
Sequence:CCGGTGGTCTGAAGCTGGTAGTTTCCTCGAGGAAACTACCAGCTTCAGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014798.2-3783s21c1
Sequence:CCGGTACGTGAGTCACCCATGAAATCTCGAGATTTCATGGGTGACTCACGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-428s1c1
Sequence:CCGGCAAACACATCATCTCAGAGTTCTCGAGAACTCTGAGATGATGTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-5103s1c1
Sequence:CCGGGAAAGGTAGTGCCCACACTATCTCGAGATAGTGTGGGCACTACCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.2-2309s21c1
Sequence:CCGGCCGCATCAGGAACAATGAGAACTCGAGTTCTCATTGTTCCTGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.1-2220s21c1
Sequence:CCGGAGGACCTGGATGCCCTATATACTCGAGTATATAGGGCATCCAGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014798.1-929s1c1
Sequence:CCGGCCTAAACTCTGATAGCTGCTTCTCGAGAAGCAGCTATCAGAGTTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-2276s1c1
Sequence:CCGGCATCAGGAACAATGAGAAGATCTCGAGATCTTCTCATTGTTCCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014798.1-2273s1c1
Sequence:CCGGCCGCATCAGGAACAATGAGAACTCGAGTTCTCATTGTTCCTGATGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014798.2-1079s21c1
Sequence:CCGGCCGGTCTCTGCAAGAGGTATTCTCGAGAATACCTCTTGCAGAGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)