EMAIL THIS PAGE TO A FRIEND

PLEKHO1

pleckstrin homology domain containing, family O member 1

48 Gene Product Result for
Synonyms: CKIP-1 OC120
UniProtKB ID: Q53GL0, Q336K5, Q8IZ51, Q9NRV3, Q9UL48
Gene ID:
Mouse(67220) pleckstrin homology domain containing, family O member 1
Rat(310674) pleckstrin homology domain containing, family O member 1
cow(788251) pleckstrin homology domain containing, family O member 1
sheep(101116531) pleckstrin homology domain containing, family O member 1
naked mole-rat(101715008) pleckstrin homology domain containing, family O member 1
Domestic Rabbit(100347162) pleckstrin homology domain containing, family O member 1
domestic guinea pig(100719740) pleckstrin homology domain containing, family O member 1
chicken(426108) pleckstrin homology domain containing, family O member 1
domestic cat(101089454) pleckstrin homology domain containing, family O member 1
dog(607927) pleckstrin homology domain containing, family O member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016274 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016274 Rosetta Predictions human pricing
NM_001025119 Rosetta Predictions rat pricing
NM_023320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099271 predicted 899
2 SASI_Hs01_00099272 predicted 829
3 SASI_Hs01_00099273 predicted 702
4 SASI_Hs01_00099274 predicted 697
5 SASI_Hs01_00099275 predicted 674
6 SASI_Hs01_00099276 predicted 548
7 SASI_Hs01_00099277 predicted 633
8 SASI_Hs01_00099278 predicted 577
9 SASI_Hs01_00099279 predicted 831
10 SASI_Hs01_00099280 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105763 predicted 514
2 SASI_Rn01_00105764 predicted 736
3 SASI_Rn01_00105765 predicted 752
4 SASI_Rn01_00105766 predicted 349
5 SASI_Rn01_00105767 predicted 757
6 SASI_Rn01_00105768 predicted 511
7 SASI_Rn01_00105769 predicted 340
8 SASI_Rn02_00203016 predicted 898
9 SASI_Rn01_00105770 predicted 557
10 SASI_Rn02_00203017 predicted 734
11 SASI_Rn01_00105771 predicted 738
12 SASI_Rn01_00105772 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185126 predicted 226
2 SASI_Mm01_00185127 predicted 423
3 SASI_Mm01_00185128 predicted 655
4 SASI_Mm01_00185129 predicted 252
5 SASI_Mm01_00185130 predicted 234
6 SASI_Mm01_00185131 predicted 350
7 SASI_Mm01_00185132 predicted 465
8 SASI_Mm01_00185133 predicted 969
9 SASI_Mm01_00185134 predicted 589
10 SASI_Mm01_00185135 predicted 388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023320
VALIDATED
PLEKHO1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family O member 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023320.2-269s21c1
Sequence:CCGGAGTGCGAAGAGCTCCGGAAATCTCGAGATTTCCGGAGCTCTTCGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023320.2-122s21c1
Sequence:CCGGTCCGGAAATTCTGCGGGAAAGCTCGAGCTTTCCCGCAGAATTTCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023320.2-201s21c1
Sequence:CCGGCGTCTCCGAGAAGGAGGTAAACTCGAGTTTACCTCCTTCTCGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023320.2-413s21c1
Sequence:CCGGACGCCCTGAGTTCTGCCATTACTCGAGTAATGGCAGAACTCAGGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023320.2-578s21c1
Sequence:CCGGCCTCAGATGGGATGCTAACATCTCGAGATGTTAGCATCCCATCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023320.1-126s1c1
Sequence:CCGGGAAATTCTGCGGGAAAGGGATCTCGAGATCCCTTTCCCGCAGAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023320.1-575s1c1
Sequence:CCGGCTACCTCAGATGGGATGCTAACTCGAGTTAGCATCCCATCTGAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023320.1-904s1c1
Sequence:CCGGCTTCAAGCTGAGGAATCCCTACTCGAGTAGGGATTCCTCAGCTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023320.1-578s1c1
Sequence:CCGGCCTCAGATGGGATGCTAACATCTCGAGATGTTAGCATCCCATCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023320.1-386s1c1
Sequence:CCGGGTCCTGAAGAGAAGGAGTCATCTCGAGATGACTCCTTCTCTTCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023320.1-591s1c1
Sequence:CCGGGCTAACATTAGACCTGATCCACTCGAGTGGATCAGGTCTAATGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023320.1-898s1c1
Sequence:CCGGCTTCACCTTCAAGCTGAGGAACTCGAGTTCCTCAGCTTGAAGGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023320
VALIDATED
PLEKHO1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family O member 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023320.2-269s21c1
Sequence:CCGGAGTGCGAAGAGCTCCGGAAATCTCGAGATTTCCGGAGCTCTTCGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023320.2-122s21c1
Sequence:CCGGTCCGGAAATTCTGCGGGAAAGCTCGAGCTTTCCCGCAGAATTTCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023320.2-201s21c1
Sequence:CCGGCGTCTCCGAGAAGGAGGTAAACTCGAGTTTACCTCCTTCTCGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023320.2-413s21c1
Sequence:CCGGACGCCCTGAGTTCTGCCATTACTCGAGTAATGGCAGAACTCAGGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023320.2-578s21c1
Sequence:CCGGCCTCAGATGGGATGCTAACATCTCGAGATGTTAGCATCCCATCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023320.1-126s1c1
Sequence:CCGGGAAATTCTGCGGGAAAGGGATCTCGAGATCCCTTTCCCGCAGAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023320.1-575s1c1
Sequence:CCGGCTACCTCAGATGGGATGCTAACTCGAGTTAGCATCCCATCTGAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023320.1-904s1c1
Sequence:CCGGCTTCAAGCTGAGGAATCCCTACTCGAGTAGGGATTCCTCAGCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023320.1-578s1c1
Sequence:CCGGCCTCAGATGGGATGCTAACATCTCGAGATGTTAGCATCCCATCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023320.1-386s1c1
Sequence:CCGGGTCCTGAAGAGAAGGAGTCATCTCGAGATGACTCCTTCTCTTCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023320.1-591s1c1
Sequence:CCGGGCTAACATTAGACCTGATCCACTCGAGTGGATCAGGTCTAATGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023320.1-898s1c1
Sequence:CCGGCTTCACCTTCAAGCTGAGGAACTCGAGTTCCTCAGCTTGAAGGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023320
VALIDATED
PLEKHO1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family O member 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023320.2-269s21c1
Sequence:CCGGAGTGCGAAGAGCTCCGGAAATCTCGAGATTTCCGGAGCTCTTCGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023320.2-122s21c1
Sequence:CCGGTCCGGAAATTCTGCGGGAAAGCTCGAGCTTTCCCGCAGAATTTCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023320.2-201s21c1
Sequence:CCGGCGTCTCCGAGAAGGAGGTAAACTCGAGTTTACCTCCTTCTCGGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023320.2-413s21c1
Sequence:CCGGACGCCCTGAGTTCTGCCATTACTCGAGTAATGGCAGAACTCAGGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023320.2-578s21c1
Sequence:CCGGCCTCAGATGGGATGCTAACATCTCGAGATGTTAGCATCCCATCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023320.1-126s1c1
Sequence:CCGGGAAATTCTGCGGGAAAGGGATCTCGAGATCCCTTTCCCGCAGAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023320.1-575s1c1
Sequence:CCGGCTACCTCAGATGGGATGCTAACTCGAGTTAGCATCCCATCTGAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023320.1-904s1c1
Sequence:CCGGCTTCAAGCTGAGGAATCCCTACTCGAGTAGGGATTCCTCAGCTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023320.1-578s1c1
Sequence:CCGGCCTCAGATGGGATGCTAACATCTCGAGATGTTAGCATCCCATCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023320.1-386s1c1
Sequence:CCGGGTCCTGAAGAGAAGGAGTCATCTCGAGATGACTCCTTCTCTTCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023320.1-591s1c1
Sequence:CCGGGCTAACATTAGACCTGATCCACTCGAGTGGATCAGGTCTAATGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023320.1-898s1c1
Sequence:CCGGCTTCACCTTCAAGCTGAGGAACTCGAGTTCCTCAGCTTGAAGGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016274
VALIDATED
PLEKHO1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family O member 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016274.4-560s21c1
Sequence:CCGGGTTTACTCTTGCCCACTCCAACTCGAGTTGGAGTGGGCAAGAGTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016274.4-1357s21c1
Sequence:CCGGGAGAGGCATCATCGAATTGGACTCGAGTCCAATTCGATGATGCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016274.4-678s21c1
Sequence:CCGGGCCAAGAACCGTATCTTGGATCTCGAGATCCAAGATACGGTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016274.4-621s21c1
Sequence:CCGGGTGAGTCCAGAAGAGAAGGAACTCGAGTTCCTTCTCTTCTGGACTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-437s1c1
Sequence:CCGGCCAGCTCTACATCTCTGAGAACTCGAGTTCTCAGAGATGTAGAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-627s1c1
Sequence:CCGGGTGAGTCCAGAAGAGAAGGAACTCGAGTTCCTTCTCTTCTGGACTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-684s1c1
Sequence:CCGGGCCAAGAACCGTATCTTGGATCTCGAGATCCAAGATACGGTTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-1363s1c1
Sequence:CCGGGAGAGGCATCATCGAATTGGACTCGAGTCCAATTCGATGATGCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-489s1c1
Sequence:CCGGGTATTTGACCTGAGTGACTATCTCGAGATAGTCACTCAGGTCAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-639s1c1
Sequence:CCGGGAGAAGGAATCGTGGATCAATCTCGAGATTGATCCACGATTCCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-686s1c1
Sequence:CCGGCAAGAACCGTATCTTGGATGACTCGAGTCATCCAAGATACGGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-566s1c1
Sequence:CCGGGTTTACTCTTGCCCACTCCAACTCGAGTTGGAGTGGGCAAGAGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-562s1c1
Sequence:CCGGGCAAGTTTACTCTTGCCCACTCTCGAGAGTGGGCAAGAGTAAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-1421s1c1
Sequence:CCGGGAGAGACCTGTACAGACAGATCTCGAGATCTGTCTGTACAGGTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-833s1c1
Sequence:CCGGGATGCTGACCTTGGACTTGATCTCGAGATCAAGTCCAAGGTCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-631s1c1
Sequence:CCGGGTCCAGAAGAGAAGGAATCGTCTCGAGACGATTCCTTCTCTTCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016274
VALIDATED
PLEKHO1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family O member 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016274.4-560s21c1
Sequence:CCGGGTTTACTCTTGCCCACTCCAACTCGAGTTGGAGTGGGCAAGAGTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016274.4-1357s21c1
Sequence:CCGGGAGAGGCATCATCGAATTGGACTCGAGTCCAATTCGATGATGCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016274.4-678s21c1
Sequence:CCGGGCCAAGAACCGTATCTTGGATCTCGAGATCCAAGATACGGTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016274.4-621s21c1
Sequence:CCGGGTGAGTCCAGAAGAGAAGGAACTCGAGTTCCTTCTCTTCTGGACTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-437s1c1
Sequence:CCGGCCAGCTCTACATCTCTGAGAACTCGAGTTCTCAGAGATGTAGAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-627s1c1
Sequence:CCGGGTGAGTCCAGAAGAGAAGGAACTCGAGTTCCTTCTCTTCTGGACTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-684s1c1
Sequence:CCGGGCCAAGAACCGTATCTTGGATCTCGAGATCCAAGATACGGTTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-1363s1c1
Sequence:CCGGGAGAGGCATCATCGAATTGGACTCGAGTCCAATTCGATGATGCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-489s1c1
Sequence:CCGGGTATTTGACCTGAGTGACTATCTCGAGATAGTCACTCAGGTCAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-639s1c1
Sequence:CCGGGAGAAGGAATCGTGGATCAATCTCGAGATTGATCCACGATTCCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-686s1c1
Sequence:CCGGCAAGAACCGTATCTTGGATGACTCGAGTCATCCAAGATACGGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-566s1c1
Sequence:CCGGGTTTACTCTTGCCCACTCCAACTCGAGTTGGAGTGGGCAAGAGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-562s1c1
Sequence:CCGGGCAAGTTTACTCTTGCCCACTCTCGAGAGTGGGCAAGAGTAAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-1421s1c1
Sequence:CCGGGAGAGACCTGTACAGACAGATCTCGAGATCTGTCTGTACAGGTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-833s1c1
Sequence:CCGGGATGCTGACCTTGGACTTGATCTCGAGATCAAGTCCAAGGTCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-631s1c1
Sequence:CCGGGTCCAGAAGAGAAGGAATCGTCTCGAGACGATTCCTTCTCTTCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016274
VALIDATED
PLEKHO1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family O member 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016274.4-560s21c1
Sequence:CCGGGTTTACTCTTGCCCACTCCAACTCGAGTTGGAGTGGGCAAGAGTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016274.4-1357s21c1
Sequence:CCGGGAGAGGCATCATCGAATTGGACTCGAGTCCAATTCGATGATGCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016274.4-678s21c1
Sequence:CCGGGCCAAGAACCGTATCTTGGATCTCGAGATCCAAGATACGGTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016274.4-621s21c1
Sequence:CCGGGTGAGTCCAGAAGAGAAGGAACTCGAGTTCCTTCTCTTCTGGACTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-437s1c1
Sequence:CCGGCCAGCTCTACATCTCTGAGAACTCGAGTTCTCAGAGATGTAGAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-627s1c1
Sequence:CCGGGTGAGTCCAGAAGAGAAGGAACTCGAGTTCCTTCTCTTCTGGACTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-684s1c1
Sequence:CCGGGCCAAGAACCGTATCTTGGATCTCGAGATCCAAGATACGGTTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-1363s1c1
Sequence:CCGGGAGAGGCATCATCGAATTGGACTCGAGTCCAATTCGATGATGCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-489s1c1
Sequence:CCGGGTATTTGACCTGAGTGACTATCTCGAGATAGTCACTCAGGTCAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-639s1c1
Sequence:CCGGGAGAAGGAATCGTGGATCAATCTCGAGATTGATCCACGATTCCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-686s1c1
Sequence:CCGGCAAGAACCGTATCTTGGATGACTCGAGTCATCCAAGATACGGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-566s1c1
Sequence:CCGGGTTTACTCTTGCCCACTCCAACTCGAGTTGGAGTGGGCAAGAGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-562s1c1
Sequence:CCGGGCAAGTTTACTCTTGCCCACTCTCGAGAGTGGGCAAGAGTAAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016274.3-1421s1c1
Sequence:CCGGGAGAGACCTGTACAGACAGATCTCGAGATCTGTCTGTACAGGTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-833s1c1
Sequence:CCGGGATGCTGACCTTGGACTTGATCTCGAGATCAAGTCCAAGGTCAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016274.3-631s1c1
Sequence:CCGGGTCCAGAAGAGAAGGAATCGTCTCGAGACGATTCCTTCTCTTCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)