EMAIL THIS PAGE TO A FRIEND

PLEKHS1

pleckstrin homology domain containing, family S member 1

143 Gene Product Result for
Synonyms: C10orf81 HEL185 bA211N11.2
Gene ID:
Mouse(226245) pleckstrin homology domain containing, family S member 1
Rat(499377) pleckstrin homology domain containing, family S member 1
cow(529092) pleckstrin homology domain containing, family S member 1
sheep(101122996) pleckstrin homology domain containing, family S member 1
naked mole-rat(101708593) pleckstrin homology domain containing, family S member 1
domestic guinea pig(100714874) pleckstrin homology domain containing, family S member 1
Zebrafish(100136845) pleckstrin homology domain containing, family S member 1
chicken(101666006) pleckstrin homology domain containing, family S member 1
chicken(101750407) pleckstrin homology domain containing, family S member 1
domestic cat(101081168) pleckstrin homology domain containing, family S member 1
dog(610294) pleckstrin homology domain containing, family S member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024889 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024889 Rosetta Predictions human pricing
NM_001134613 Rosetta Predictions rat pricing
XR_008090 Rosetta Predictions rat pricing
NM_172641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158963 predicted 555
2 SASI_Hs01_00158964 predicted 1204
3 SASI_Hs01_00158965 predicted 1291
4 SASI_Hs02_00357484 predicted 339
5 SASI_Hs01_00158966 predicted 1035
6 SASI_Hs01_00158967 predicted 1374
7 SASI_Hs01_00158968 predicted 1017
8 SASI_Hs01_00158969 predicted 1286
9 SASI_Hs01_00158970 predicted 912
10 SASI_Hs01_00158971 predicted 1280
11 SASI_Hs01_00158972 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134613 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257609 predicted 1204
2 SASI_Rn02_00257610 predicted 303
3 SASI_Rn02_00257611 predicted 290
4 SASI_Rn02_00257612 predicted 1018
5 SASI_Rn02_00257613 predicted 1258
6 SASI_Rn02_00257614 predicted 733
7 SASI_Rn02_00257615 predicted 1318
8 SASI_Rn02_00257616 predicted 842
9 SASI_Rn02_00257617 predicted 1269
10 SASI_Rn02_00257618 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182947 predicted 1704
2 SASI_Rn01_00182948 predicted 1205
3 SASI_Rn01_00182949 predicted 1025
4 SASI_Rn01_00182950 predicted 1634
5 SASI_Rn01_00182951 predicted 1335
6 SASI_Rn01_00182952 predicted 1627
7 SASI_Rn01_00182953 predicted 729
8 SASI_Rn01_00182954 predicted 1624
9 SASI_Rn01_00182955 predicted 725
10 SASI_Rn01_00182956 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069034 predicted 715
2 SASI_Mm01_00069035 predicted 1046
3 SASI_Mm01_00069036 predicted 708
4 SASI_Mm01_00069037 predicted 305
5 SASI_Mm01_00069038 predicted 759
6 SASI_Mm01_00069039 predicted 1237
7 SASI_Mm01_00069040 predicted 405
8 SASI_Mm01_00069041 predicted 817
9 SASI_Mm02_00344345 predicted 422
10 SASI_Mm01_00069042 predicted 1057
11 SASI_Mm01_00069043 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172641
PLEKHS1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family S member 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172641.3-473s21c1
Sequence:CCGGCCATACTGCCAGGGTGTTAAACTCGAGTTTAACACCCTGGCAGTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172641.1-1046s1c1
Sequence:CCGGCGCCTCACTAACTGTTGTGAACTCGAGTTCACAACAGTTAGTGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172641.1-1620s1c1
Sequence:CCGGCCCACATGAAATAATGACTAACTCGAGTTAGTCATTATTTCATGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172641.1-750s1c1
Sequence:CCGGGCCTGTTTAGAATTAGAGAATCTCGAGATTCTCTAATTCTAAACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172641.1-699s1c1
Sequence:CCGGCCCACCCAAGATACAGAAGAACTCGAGTTCTTCTGTATCTTGGGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172641.1-307s1c1
Sequence:CCGGCCACTGTAGAAGTTGGTATAACTCGAGTTATACCAACTTCTACAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172641.3-1709s21c1
Sequence:CCGGAGTAAATCCCTGGTCTAATTACTCGAGTAATTAGACCAGGGATTTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172641
PLEKHS1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family S member 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172641.3-473s21c1
Sequence:CCGGCCATACTGCCAGGGTGTTAAACTCGAGTTTAACACCCTGGCAGTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172641.1-1046s1c1
Sequence:CCGGCGCCTCACTAACTGTTGTGAACTCGAGTTCACAACAGTTAGTGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172641.1-1620s1c1
Sequence:CCGGCCCACATGAAATAATGACTAACTCGAGTTAGTCATTATTTCATGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172641.1-750s1c1
Sequence:CCGGGCCTGTTTAGAATTAGAGAATCTCGAGATTCTCTAATTCTAAACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172641.1-699s1c1
Sequence:CCGGCCCACCCAAGATACAGAAGAACTCGAGTTCTTCTGTATCTTGGGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172641.1-307s1c1
Sequence:CCGGCCACTGTAGAAGTTGGTATAACTCGAGTTATACCAACTTCTACAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172641.3-1709s21c1
Sequence:CCGGAGTAAATCCCTGGTCTAATTACTCGAGTAATTAGACCAGGGATTTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172641
PLEKHS1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family S member 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172641.3-473s21c1
Sequence:CCGGCCATACTGCCAGGGTGTTAAACTCGAGTTTAACACCCTGGCAGTATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172641.1-1046s1c1
Sequence:CCGGCGCCTCACTAACTGTTGTGAACTCGAGTTCACAACAGTTAGTGAGGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172641.1-1620s1c1
Sequence:CCGGCCCACATGAAATAATGACTAACTCGAGTTAGTCATTATTTCATGTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172641.1-750s1c1
Sequence:CCGGGCCTGTTTAGAATTAGAGAATCTCGAGATTCTCTAATTCTAAACAGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172641.1-699s1c1
Sequence:CCGGCCCACCCAAGATACAGAAGAACTCGAGTTCTTCTGTATCTTGGGTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172641.1-307s1c1
Sequence:CCGGCCACTGTAGAAGTTGGTATAACTCGAGTTATACCAACTTCTACAGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000423336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172641.3-1709s21c1
Sequence:CCGGAGTAAATCCCTGGTCTAATTACTCGAGTAATTAGACCAGGGATTTACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024889
PLEKHS1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain containing, family S member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-1336s1c1
Sequence:CCGGCAAGTGGAGAAACTGAACGTTCTCGAGAACGTTCAGTTTCTCCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024889.3-2147s1c1
Sequence:CCGGCCCAAACACCTCTTTCCCAAACTCGAGTTTGGGAAAGAGGTGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-1019s1c1
Sequence:CCGGCCAGTGATTCTGGTGAATCCACTCGAGTGGATTCACCAGAATCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-636s1c1
Sequence:CCGGCATGTCCATCAGAACCACTAACTCGAGTTAGTGGTTCTGATGGACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-557s1c1
Sequence:CCGGCCAGTGTAGAAGTTGGCATAACTCGAGTTATGCCAACTTCTACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024889.3-1917s1c1
Sequence:CCGGCCTTCTTTGTTAAGGGACATACTCGAGTATGTCCCTTAACAAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024889.3-2922s1c1
Sequence:CCGGGCAGAGAGCTAAAGCACTAATCTCGAGATTAGTGCTTTAGCTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-645s1c1
Sequence:CCGGCAGAACCACTAACAGGGAATACTCGAGTATTCCCTGTTAGTGGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-1015s1c1
Sequence:CCGGGCTTCCAGTGATTCTGGTGAACTCGAGTTCACCAGAATCACTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024889
PLEKHS1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain containing, family S member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-1336s1c1
Sequence:CCGGCAAGTGGAGAAACTGAACGTTCTCGAGAACGTTCAGTTTCTCCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024889.3-2147s1c1
Sequence:CCGGCCCAAACACCTCTTTCCCAAACTCGAGTTTGGGAAAGAGGTGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-1019s1c1
Sequence:CCGGCCAGTGATTCTGGTGAATCCACTCGAGTGGATTCACCAGAATCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-636s1c1
Sequence:CCGGCATGTCCATCAGAACCACTAACTCGAGTTAGTGGTTCTGATGGACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-557s1c1
Sequence:CCGGCCAGTGTAGAAGTTGGCATAACTCGAGTTATGCCAACTTCTACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024889.3-1917s1c1
Sequence:CCGGCCTTCTTTGTTAAGGGACATACTCGAGTATGTCCCTTAACAAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024889.3-2922s1c1
Sequence:CCGGGCAGAGAGCTAAAGCACTAATCTCGAGATTAGTGCTTTAGCTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-645s1c1
Sequence:CCGGCAGAACCACTAACAGGGAATACTCGAGTATTCCCTGTTAGTGGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-1015s1c1
Sequence:CCGGGCTTCCAGTGATTCTGGTGAACTCGAGTTCACCAGAATCACTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024889
PLEKHS1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain containing, family S member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-1336s1c1
Sequence:CCGGCAAGTGGAGAAACTGAACGTTCTCGAGAACGTTCAGTTTCTCCACTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000141282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024889.3-2147s1c1
Sequence:CCGGCCCAAACACCTCTTTCCCAAACTCGAGTTTGGGAAAGAGGTGTTTGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000141019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-1019s1c1
Sequence:CCGGCCAGTGATTCTGGTGAATCCACTCGAGTGGATTCACCAGAATCACTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000142969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-636s1c1
Sequence:CCGGCATGTCCATCAGAACCACTAACTCGAGTTAGTGGTTCTGATGGACATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000142995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-557s1c1
Sequence:CCGGCCAGTGTAGAAGTTGGCATAACTCGAGTTATGCCAACTTCTACACTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000144396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024889.3-1917s1c1
Sequence:CCGGCCTTCTTTGTTAAGGGACATACTCGAGTATGTCCCTTAACAAAGAAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000143249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024889.3-2922s1c1
Sequence:CCGGGCAGAGAGCTAAAGCACTAATCTCGAGATTAGTGCTTTAGCTCTCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000143656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-645s1c1
Sequence:CCGGCAGAACCACTAACAGGGAATACTCGAGTATTCCCTGTTAGTGGTTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000122639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024889.3-1015s1c1
Sequence:CCGGGCTTCCAGTGATTCTGGTGAACTCGAGTTCACCAGAATCACTGGAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???