EMAIL THIS PAGE TO A FRIEND

PLGLB1

plasminogen-like B1

109 Gene Product Result for
Synonyms: PLGL PLGP1 PRGB PRP-B
Species: Human PLGLB1(5343)
UniProtKB ID: Q02325, Q580R1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA053770 Anti-PLGLB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001032392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001032392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001032392 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032392 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245492 predicted 1050
2 SASI_Hs01_00245493 predicted 1165
3 SASI_Hs02_00307938 predicted 2899
4 SASI_Hs01_00245495 predicted 1246
5 SASI_Hs02_00307939 predicted 2206
6 SASI_Hs02_00307940 predicted 2912
7 SASI_Hs01_00245496 predicted 1079
8 SASI_Hs01_00245497 predicted 1258
9 SASI_Hs02_00307941 predicted 2177
10 SASI_Hs01_00245500 predicted 1312
11 SASI_Hs01_00245494 predicted 1032
12 SASI_Hs01_00245498 predicted 896
13 SASI_Hs01_00245499 predicted 1047
14 SASI_Hs01_00245501 predicted 1257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001032392
PLGLB1 MISSION shRNA Bacterial Glycerol Stock
plasminogen-like B1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001032392.2-630s21c1
Sequence:CCGGCTTGTGCAATCCCTAATATAACTCGAGTTATATTAGGGATTGCACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032392.2-241s21c1
Sequence:CCGGACCTGCAGGGCATTCCAATATCTCGAGATATTGGAATGCCCTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032392.2-271s21c1
Sequence:CCGGGAGCAACAATGTGTGATAATGCTCGAGCATTATCACACATTGTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032392.2-302s21c1
Sequence:CCGGGGAAGTCCTCCATAATCATTACTCGAGTAATGATTATGGAGGACTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032392.2-125s21c1
Sequence:CCGGCCCTGGATGACTATGTGAATACTCGAGTATTCACATAGTCATCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032392.1-256s1c1
Sequence:CCGGCAATGTGTGATAATGGCTGAACTCGAGTTCAGCCATTATCACACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032392.1-134s1c1
Sequence:CCGGCTTCACTGTTCAGTGTCACTACTCGAGTAGTGACACTGAACAGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032392.1-104s1c1
Sequence:CCGGCCCTGGATGACTATGTGAATACTCGAGTATTCACATAGTCATCCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001032392
PLGLB1 MISSION shRNA shRNA Plasmid DNA
plasminogen-like B1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001032392.2-630s21c1
Sequence:CCGGCTTGTGCAATCCCTAATATAACTCGAGTTATATTAGGGATTGCACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032392.2-241s21c1
Sequence:CCGGACCTGCAGGGCATTCCAATATCTCGAGATATTGGAATGCCCTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032392.2-271s21c1
Sequence:CCGGGAGCAACAATGTGTGATAATGCTCGAGCATTATCACACATTGTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032392.2-302s21c1
Sequence:CCGGGGAAGTCCTCCATAATCATTACTCGAGTAATGATTATGGAGGACTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032392.2-125s21c1
Sequence:CCGGCCCTGGATGACTATGTGAATACTCGAGTATTCACATAGTCATCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032392.1-256s1c1
Sequence:CCGGCAATGTGTGATAATGGCTGAACTCGAGTTCAGCCATTATCACACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032392.1-134s1c1
Sequence:CCGGCTTCACTGTTCAGTGTCACTACTCGAGTAGTGACACTGAACAGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032392.1-104s1c1
Sequence:CCGGCCCTGGATGACTATGTGAATACTCGAGTATTCACATAGTCATCCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001032392
PLGLB1 MISSION shRNA Lentiviral Transduction Particles
plasminogen-like B1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001032392.2-630s21c1
Sequence:CCGGCTTGTGCAATCCCTAATATAACTCGAGTTATATTAGGGATTGCACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032392.2-241s21c1
Sequence:CCGGACCTGCAGGGCATTCCAATATCTCGAGATATTGGAATGCCCTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032392.2-271s21c1
Sequence:CCGGGAGCAACAATGTGTGATAATGCTCGAGCATTATCACACATTGTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032392.2-302s21c1
Sequence:CCGGGGAAGTCCTCCATAATCATTACTCGAGTAATGATTATGGAGGACTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032392.2-125s21c1
Sequence:CCGGCCCTGGATGACTATGTGAATACTCGAGTATTCACATAGTCATCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032392.1-256s1c1
Sequence:CCGGCAATGTGTGATAATGGCTGAACTCGAGTTCAGCCATTATCACACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032392.1-134s1c1
Sequence:CCGGCTTCACTGTTCAGTGTCACTACTCGAGTAGTGACACTGAACAGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032392.1-104s1c1
Sequence:CCGGCCCTGGATGACTATGTGAATACTCGAGTATTCACATAGTCATCCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)