EMAIL THIS PAGE TO A FRIEND

PLGRKT

plasminogen receptor, C-terminal lysine transmembrane protein

70 Gene Product Result for
Synonyms: C9orf46 MDS030 PLG-RKT Plg-R(KT)
UniProtKB ID: Q9HBL7, B2R6W0, Q9NZ44
Gene ID:
Mouse(67759) plasminogen receptor, C-terminal lysine transmembrane protein
Rat(293888) plasminogen receptor, C-terminal lysine transmembrane protein
Zebrafish(606662) plasminogen receptor, C-terminal lysine transmembrane protein
domestic cat(101098342) plasminogen receptor, C-terminal lysine transmembrane protein
dog(609677) plasminogen receptor, C-terminal lysine transmembrane protein
cow(512609) plasminogen receptor, C-terminal lysine transmembrane protein
sheep(101114587) plasminogen receptor, C-terminal lysine transmembrane protein
naked mole-rat(101718741) plasminogen receptor, C-terminal lysine transmembrane protein
domestic guinea pig(100719885) plasminogen receptor, C-terminal lysine transmembrane protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018465 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018465 Rosetta Predictions human pricing
NM_001106347 Rosetta Predictions rat pricing
NM_026362 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010976 predicted 849
2 SASI_Hs01_00010977 predicted 679
3 SASI_Hs01_00010978 predicted 346
4 SASI_Hs02_00352031 predicted 462
5 SASI_Hs01_00010979 predicted 350
6 SASI_Hs02_00352032 predicted 305
7 SASI_Hs01_00010981 predicted 671
8 SASI_Hs01_00010982 predicted 218
9 SASI_Hs01_00010983 predicted 853
10 SASI_Hs01_00010984 predicted 676
11 SASI_Hs01_00010980 predicted 651
12 SASI_Hs01_00010985 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218078 predicted 411
2 SASI_Rn02_00218079 predicted 793
3 SASI_Rn02_00218080 predicted 700
4 SASI_Rn02_00218081 predicted 592
5 SASI_Rn02_00218082 predicted 442
6 SASI_Rn02_00218083 predicted 715
7 SASI_Rn02_00218084 predicted 752
8 SASI_Rn02_00218085 predicted 744
9 SASI_Rn02_00218086 predicted 676
10 SASI_Rn02_00218087 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062295 predicted 299
2 SASI_Mm01_00062296 predicted 594
3 SASI_Mm01_00062297 predicted 335
4 SASI_Mm01_00062298 predicted 337
5 SASI_Mm01_00062300 predicted 608
6 SASI_Mm01_00062301 predicted 569
7 SASI_Mm01_00062302 predicted 384
8 SASI_Mm01_00062303 predicted 201
9 SASI_Mm01_00062304 predicted 239
10 SASI_Mm02_00330083 predicted 612
11 SASI_Mm01_00062299 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018465
VALIDATED
PLGRKT MISSION shRNA Bacterial Glycerol Stock
plasminogen receptor, C-terminal lysine transmembrane protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018465.2-264s21c1
Sequence:CCGGGCTTATGAATGCTCGACTTCACTCGAGTGAAGTCGAGCATTCATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018465.2-532s21c1
Sequence:CCGGGCTGAGGACATACTGGAAACACTCGAGTGTTTCCAGTATGTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018465.2-451s21c1
Sequence:CCGGCCGATTGTTCCATTAAGCTTTCTCGAGAAAGCTTAATGGAACAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018465.2-660s21c1
Sequence:CCGGCCAATCAAATCTCAAAGCACACTCGAGTGTGCTTTGAGATTTGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018465.1-611s1c1
Sequence:CCGGGCCAGAAAGGAACAGAGTAGACTCGAGTCTACTCTGTTCCTTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-265s1c1
Sequence:CCGGGCTTATGAATGCTCGACTTCACTCGAGTGAAGTCGAGCATTCATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-533s1c1
Sequence:CCGGGCTGAGGACATACTGGAAACACTCGAGTGTTTCCAGTATGTCCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-661s1c1
Sequence:CCGGCCAATCAAATCTCAAAGCACACTCGAGTGTGCTTTGAGATTTGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-405s1c1
Sequence:CCGGCTTTAACAGCTGGAGCGATTACTCGAGTAATCGCTCCAGCTGTTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018465.1-475s1c1
Sequence:CCGGCCTCACCTACCAGTATGACTTCTCGAGAAGTCATACTGGTAGGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-452s1c1
Sequence:CCGGCCGATTGTTCCATTAAGCTTTCTCGAGAAAGCTTAATGGAACAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018465
VALIDATED
PLGRKT MISSION shRNA shRNA Plasmid DNA
plasminogen receptor, C-terminal lysine transmembrane protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018465.2-264s21c1
Sequence:CCGGGCTTATGAATGCTCGACTTCACTCGAGTGAAGTCGAGCATTCATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018465.2-532s21c1
Sequence:CCGGGCTGAGGACATACTGGAAACACTCGAGTGTTTCCAGTATGTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018465.2-451s21c1
Sequence:CCGGCCGATTGTTCCATTAAGCTTTCTCGAGAAAGCTTAATGGAACAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018465.2-660s21c1
Sequence:CCGGCCAATCAAATCTCAAAGCACACTCGAGTGTGCTTTGAGATTTGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018465.1-611s1c1
Sequence:CCGGGCCAGAAAGGAACAGAGTAGACTCGAGTCTACTCTGTTCCTTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-265s1c1
Sequence:CCGGGCTTATGAATGCTCGACTTCACTCGAGTGAAGTCGAGCATTCATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-533s1c1
Sequence:CCGGGCTGAGGACATACTGGAAACACTCGAGTGTTTCCAGTATGTCCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-661s1c1
Sequence:CCGGCCAATCAAATCTCAAAGCACACTCGAGTGTGCTTTGAGATTTGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-405s1c1
Sequence:CCGGCTTTAACAGCTGGAGCGATTACTCGAGTAATCGCTCCAGCTGTTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018465.1-475s1c1
Sequence:CCGGCCTCACCTACCAGTATGACTTCTCGAGAAGTCATACTGGTAGGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-452s1c1
Sequence:CCGGCCGATTGTTCCATTAAGCTTTCTCGAGAAAGCTTAATGGAACAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018465
VALIDATED
PLGRKT MISSION shRNA Lentiviral Transduction Particles
plasminogen receptor, C-terminal lysine transmembrane protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018465.2-264s21c1
Sequence:CCGGGCTTATGAATGCTCGACTTCACTCGAGTGAAGTCGAGCATTCATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018465.2-532s21c1
Sequence:CCGGGCTGAGGACATACTGGAAACACTCGAGTGTTTCCAGTATGTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018465.2-451s21c1
Sequence:CCGGCCGATTGTTCCATTAAGCTTTCTCGAGAAAGCTTAATGGAACAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018465.2-660s21c1
Sequence:CCGGCCAATCAAATCTCAAAGCACACTCGAGTGTGCTTTGAGATTTGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018465.1-611s1c1
Sequence:CCGGGCCAGAAAGGAACAGAGTAGACTCGAGTCTACTCTGTTCCTTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-265s1c1
Sequence:CCGGGCTTATGAATGCTCGACTTCACTCGAGTGAAGTCGAGCATTCATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-533s1c1
Sequence:CCGGGCTGAGGACATACTGGAAACACTCGAGTGTTTCCAGTATGTCCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-661s1c1
Sequence:CCGGCCAATCAAATCTCAAAGCACACTCGAGTGTGCTTTGAGATTTGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-405s1c1
Sequence:CCGGCTTTAACAGCTGGAGCGATTACTCGAGTAATCGCTCCAGCTGTTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018465.1-475s1c1
Sequence:CCGGCCTCACCTACCAGTATGACTTCTCGAGAAGTCATACTGGTAGGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018465.1-452s1c1
Sequence:CCGGCCGATTGTTCCATTAAGCTTTCTCGAGAAAGCTTAATGGAACAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026362
VALIDATED
PLGRKT MISSION shRNA Bacterial Glycerol Stock
plasminogen receptor, C-terminal lysine transmembrane protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026362.2-424s21c1
Sequence:CCGGCCAGCCTTTCTCGTTCCTATACTCGAGTATAGGAACGAGAAAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026362.2-628s21c1
Sequence:CCGGGACAAATGAAGTCACAGTTATCTCGAGATAACTGTGACTTCATTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026362.2-458s21c1
Sequence:CCGGTCATCTTCACCTACCAGTATGCTCGAGCATACTGGTAGGTGAAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026362.2-676s21c1
Sequence:CCGGGCACAAAGTTGTTGGCTTGAACTCGAGTTCAAGCCAACAACTTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026362.2-392s21c1
Sequence:CCGGCTTTAGCAACTGGAGCACTAACTCGAGTTAGTGCTCCAGTTGCTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026362.1-677s1c1
Sequence:CCGGGCACAAAGTTGTTGGCTTGAACTCGAGTTCAAGCCAACAACTTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026362.1-524s1c1
Sequence:CCGGGAGGACATATTGGAAACAGAACTCGAGTTCTGTTTCCAATATGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026362.1-393s1c1
Sequence:CCGGCTTTAGCAACTGGAGCACTAACTCGAGTTAGTGCTCCAGTTGCTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026362.1-577s1c1
Sequence:CCGGCACCTTTGAAAGCCTTGAGAACTCGAGTTCTCAAGGCTTTCAAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026362.1-425s1c1
Sequence:CCGGCCAGCCTTTCTCGTTCCTATACTCGAGTATAGGAACGAGAAAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026362
VALIDATED
PLGRKT MISSION shRNA shRNA Plasmid DNA
plasminogen receptor, C-terminal lysine transmembrane protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026362.2-424s21c1
Sequence:CCGGCCAGCCTTTCTCGTTCCTATACTCGAGTATAGGAACGAGAAAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026362.2-628s21c1
Sequence:CCGGGACAAATGAAGTCACAGTTATCTCGAGATAACTGTGACTTCATTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026362.2-458s21c1
Sequence:CCGGTCATCTTCACCTACCAGTATGCTCGAGCATACTGGTAGGTGAAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026362.2-676s21c1
Sequence:CCGGGCACAAAGTTGTTGGCTTGAACTCGAGTTCAAGCCAACAACTTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026362.2-392s21c1
Sequence:CCGGCTTTAGCAACTGGAGCACTAACTCGAGTTAGTGCTCCAGTTGCTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026362.1-677s1c1
Sequence:CCGGGCACAAAGTTGTTGGCTTGAACTCGAGTTCAAGCCAACAACTTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026362.1-524s1c1
Sequence:CCGGGAGGACATATTGGAAACAGAACTCGAGTTCTGTTTCCAATATGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026362.1-393s1c1
Sequence:CCGGCTTTAGCAACTGGAGCACTAACTCGAGTTAGTGCTCCAGTTGCTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026362.1-577s1c1
Sequence:CCGGCACCTTTGAAAGCCTTGAGAACTCGAGTTCTCAAGGCTTTCAAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026362.1-425s1c1
Sequence:CCGGCCAGCCTTTCTCGTTCCTATACTCGAGTATAGGAACGAGAAAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026362
VALIDATED
PLGRKT MISSION shRNA Lentiviral Transduction Particles
plasminogen receptor, C-terminal lysine transmembrane protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026362.2-424s21c1
Sequence:CCGGCCAGCCTTTCTCGTTCCTATACTCGAGTATAGGAACGAGAAAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026362.2-628s21c1
Sequence:CCGGGACAAATGAAGTCACAGTTATCTCGAGATAACTGTGACTTCATTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026362.2-458s21c1
Sequence:CCGGTCATCTTCACCTACCAGTATGCTCGAGCATACTGGTAGGTGAAGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026362.2-676s21c1
Sequence:CCGGGCACAAAGTTGTTGGCTTGAACTCGAGTTCAAGCCAACAACTTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026362.2-392s21c1
Sequence:CCGGCTTTAGCAACTGGAGCACTAACTCGAGTTAGTGCTCCAGTTGCTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026362.1-677s1c1
Sequence:CCGGGCACAAAGTTGTTGGCTTGAACTCGAGTTCAAGCCAACAACTTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026362.1-524s1c1
Sequence:CCGGGAGGACATATTGGAAACAGAACTCGAGTTCTGTTTCCAATATGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026362.1-393s1c1
Sequence:CCGGCTTTAGCAACTGGAGCACTAACTCGAGTTAGTGCTCCAGTTGCTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026362.1-577s1c1
Sequence:CCGGCACCTTTGAAAGCCTTGAGAACTCGAGTTCTCAAGGCTTTCAAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026362.1-425s1c1
Sequence:CCGGCCAGCCTTTCTCGTTCCTATACTCGAGTATAGGAACGAGAAAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)