EMAIL THIS PAGE TO A FRIEND

PLIN2

perilipin 2

86 Gene Product Result for
Synonyms: ADFP ADRP
UniProtKB ID: Q99541, Q9BSC3
Gene ID:
Human(123) Summary: The protein encoded by this gene belongs to the perilipin family, members of which coat intracellular lipid storage droplets. This protein is associated with the lipid globule surface membrane material, and maybe involved in development and maintenance of adipose tissue. However, it is not restricted to adipocytes as previously thought, but is found in a wide range of cultured cell lines, including fibroblasts, endothelial and epithelial cells, and tissues, such as lactating mammary gland, adrenal cortex, Sertoli and Leydig cells, and hepatocytes in alcoholic liver cirrhosis, suggesting that it may serve as a marker of lipid accumulation in diverse cell types and diseases. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
Mouse(11520) perilipin 2
Rat(298199) perilipin 2
cow(280981) perilipin 2
sheep(100125354) perilipin 2
Goat(100861245) perilipin 2
Zebrafish(794841) perilipin 2
chicken(427237) perilipin 2
dog(474720) perilipin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001122 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105291 MISSION® esiRNA esiRNA human ADFP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122 Rosetta Predictions human pricing
NM_001007144 Rosetta Predictions rat pricing
NM_007408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066898 predicted 719
2 SASI_Hs01_00066899 predicted 809
3 SASI_Hs02_00327053 predicted 1107
4 SASI_Hs01_00066900 predicted 1555
5 SASI_Hs01_00066902 predicted 937
6 SASI_Hs01_00066904 predicted 1092
7 SASI_Hs02_00327054 predicted 1329
8 SASI_Hs01_00066906 predicted 1243
9 SASI_Hs01_00066907 predicted 473
10 SASI_Hs02_00327055 predicted 380
11 SASI_Hs01_00066901 predicted 467
12 SASI_Hs01_00066903 predicted 976
13 SASI_Hs01_00066905 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198616 predicted 920
2 SASI_Rn01_00088855 predicted 292
3 SASI_Rn01_00088857 predicted 1074
4 SASI_Rn01_00088858 predicted 957
5 SASI_Rn01_00088859 predicted 893
6 SASI_Rn01_00088860 predicted 360
7 SASI_Rn01_00088861 predicted 906
8 SASI_Rn01_00088862 predicted 608
9 SASI_Rn02_00198617 predicted 505
10 SASI_Rn02_00198618 predicted 831
11 SASI_Rn01_00088853 predicted 206
12 SASI_Rn01_00088854 predicted 838
13 SASI_Rn01_00088856 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311543 predicted 754
2 SASI_Mm02_00311544 predicted 253
3 SASI_Mm01_00081180 predicted 843
4 SASI_Mm01_00081183 predicted 1139
5 SASI_Mm01_00081187 predicted 1422
6 SASI_Mm01_00081188 predicted 405
7 SASI_Mm02_00311545 predicted 239
8 SASI_Mm02_00311546 predicted 414
9 SASI_Mm02_00311547 predicted 912
10 SASI_Mm02_00311548 predicted 906
11 SASI_Mm01_00081181 predicted 349
12 SASI_Mm01_00081182 predicted 1290
13 SASI_Mm01_00081184 predicted 434
14 SASI_Mm01_00081185 predicted 1270
15 SASI_Mm01_00081186 predicted 1483
16 SASI_Mm01_00081189 predicted 1279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001122
VALIDATED
PLIN2 MISSION shRNA Bacterial Glycerol Stock
perilipin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122.2-1572s21c1
Sequence:CCGGCCCTAAATTGGGAAGCAAGTACTCGAGTACTTGCTTCCCAATTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122.2-387s21c1
Sequence:CCGGCAGAAGCTAGAGCCGCAAATTCTCGAGAATTTGCGGCTCTAGCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122.2-1330s21c1
Sequence:CCGGCTTTAGATGACGTGATGGATTCTCGAGAATCCATCACGTCATCTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122.2-808s21c1
Sequence:CCGGTGGTTCAGAAGCCAAGTTATTCTCGAGAATAACTTGGCTTCTGAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001122.2-1330s1c1
Sequence:CCGGCTTTAGATGACGTGATGGATTCTCGAGAATCCATCACGTCATCTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001122.2-1087s1c1
Sequence:CCGGCTGAGCACATTGAGTCACGTACTCGAGTACGTGACTCAATGTGCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001122.2-474s1c1
Sequence:CCGGCAGCCATCAACTCAGATTGTTCTCGAGAACAATCTGAGTTGATGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001122.2-1572s1c1
Sequence:CCGGCCCTAAATTGGGAAGCAAGTACTCGAGTACTTGCTTCCCAATTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001122.2-938s1c1
Sequence:CCGGCCATTCTACTGTTCACCTGATCTCGAGATCAGGTGAACAGTAGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122.2-474s21c1
Sequence:CCGGCAGCCATCAACTCAGATTGTTCTCGAGAACAATCTGAGTTGATGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001122
VALIDATED
PLIN2 MISSION shRNA shRNA Plasmid DNA
perilipin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122.2-1572s21c1
Sequence:CCGGCCCTAAATTGGGAAGCAAGTACTCGAGTACTTGCTTCCCAATTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122.2-387s21c1
Sequence:CCGGCAGAAGCTAGAGCCGCAAATTCTCGAGAATTTGCGGCTCTAGCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122.2-1330s21c1
Sequence:CCGGCTTTAGATGACGTGATGGATTCTCGAGAATCCATCACGTCATCTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122.2-808s21c1
Sequence:CCGGTGGTTCAGAAGCCAAGTTATTCTCGAGAATAACTTGGCTTCTGAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001122.2-1330s1c1
Sequence:CCGGCTTTAGATGACGTGATGGATTCTCGAGAATCCATCACGTCATCTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001122.2-1087s1c1
Sequence:CCGGCTGAGCACATTGAGTCACGTACTCGAGTACGTGACTCAATGTGCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001122.2-474s1c1
Sequence:CCGGCAGCCATCAACTCAGATTGTTCTCGAGAACAATCTGAGTTGATGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001122.2-1572s1c1
Sequence:CCGGCCCTAAATTGGGAAGCAAGTACTCGAGTACTTGCTTCCCAATTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001122.2-938s1c1
Sequence:CCGGCCATTCTACTGTTCACCTGATCTCGAGATCAGGTGAACAGTAGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122.2-474s21c1
Sequence:CCGGCAGCCATCAACTCAGATTGTTCTCGAGAACAATCTGAGTTGATGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001122
VALIDATED
PLIN2 MISSION shRNA Lentiviral Transduction Particles
perilipin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122.2-1572s21c1
Sequence:CCGGCCCTAAATTGGGAAGCAAGTACTCGAGTACTTGCTTCCCAATTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122.2-387s21c1
Sequence:CCGGCAGAAGCTAGAGCCGCAAATTCTCGAGAATTTGCGGCTCTAGCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122.2-1330s21c1
Sequence:CCGGCTTTAGATGACGTGATGGATTCTCGAGAATCCATCACGTCATCTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122.2-808s21c1
Sequence:CCGGTGGTTCAGAAGCCAAGTTATTCTCGAGAATAACTTGGCTTCTGAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001122.2-1330s1c1
Sequence:CCGGCTTTAGATGACGTGATGGATTCTCGAGAATCCATCACGTCATCTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001122.2-1087s1c1
Sequence:CCGGCTGAGCACATTGAGTCACGTACTCGAGTACGTGACTCAATGTGCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001122.2-474s1c1
Sequence:CCGGCAGCCATCAACTCAGATTGTTCTCGAGAACAATCTGAGTTGATGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001122.2-1572s1c1
Sequence:CCGGCCCTAAATTGGGAAGCAAGTACTCGAGTACTTGCTTCCCAATTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001122.2-938s1c1
Sequence:CCGGCCATTCTACTGTTCACCTGATCTCGAGATCAGGTGAACAGTAGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122.2-474s21c1
Sequence:CCGGCAGCCATCAACTCAGATTGTTCTCGAGAACAATCTGAGTTGATGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007408
VALIDATED
PLIN2 MISSION shRNA Bacterial Glycerol Stock
perilipin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-1131s21c1
Sequence:CCGGCCAAGGGTTACCACAGAACATCTCGAGATGTTCTGTGGTAACCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-361s21c1
Sequence:CCGGCCACAAATTGCGGTTGCCAATCTCGAGATTGGCAACCGCAATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-909s21c1
Sequence:CCGGCCTGATTGAATTCGCCAGGAACTCGAGTTCCTGGCGAATTCAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-230s21c1
Sequence:CCGGCCTCCGCTTATGTCAGTACAACTCGAGTTGTACTGACATAAGCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-219s1c1
Sequence:CCGGCCTCCGCTTATGTCAGTACAACTCGAGTTGTACTGACATAAGCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-1120s1c1
Sequence:CCGGCCAAGGGTTACCACAGAACATCTCGAGATGTTCTGTGGTAACCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-898s1c1
Sequence:CCGGCCTGATTGAATTCGCCAGGAACTCGAGTTCCTGGCGAATTCAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-350s1c1
Sequence:CCGGCCACAAATTGCGGTTGCCAATCTCGAGATTGGCAACCGCAATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-1275s1c1
Sequence:CCGGCCTTAGATGAAGTTATGGATTCTCGAGAATCCATAACTTCATCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-1286s21c1
Sequence:CCGGCCTTAGATGAAGTTATGGATTCTCGAGAATCCATAACTTCATCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007408
VALIDATED
PLIN2 MISSION shRNA shRNA Plasmid DNA
perilipin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-1131s21c1
Sequence:CCGGCCAAGGGTTACCACAGAACATCTCGAGATGTTCTGTGGTAACCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-361s21c1
Sequence:CCGGCCACAAATTGCGGTTGCCAATCTCGAGATTGGCAACCGCAATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-909s21c1
Sequence:CCGGCCTGATTGAATTCGCCAGGAACTCGAGTTCCTGGCGAATTCAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-230s21c1
Sequence:CCGGCCTCCGCTTATGTCAGTACAACTCGAGTTGTACTGACATAAGCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-219s1c1
Sequence:CCGGCCTCCGCTTATGTCAGTACAACTCGAGTTGTACTGACATAAGCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-1120s1c1
Sequence:CCGGCCAAGGGTTACCACAGAACATCTCGAGATGTTCTGTGGTAACCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-898s1c1
Sequence:CCGGCCTGATTGAATTCGCCAGGAACTCGAGTTCCTGGCGAATTCAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-350s1c1
Sequence:CCGGCCACAAATTGCGGTTGCCAATCTCGAGATTGGCAACCGCAATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-1275s1c1
Sequence:CCGGCCTTAGATGAAGTTATGGATTCTCGAGAATCCATAACTTCATCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-1286s21c1
Sequence:CCGGCCTTAGATGAAGTTATGGATTCTCGAGAATCCATAACTTCATCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007408
VALIDATED
PLIN2 MISSION shRNA Lentiviral Transduction Particles
perilipin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-1131s21c1
Sequence:CCGGCCAAGGGTTACCACAGAACATCTCGAGATGTTCTGTGGTAACCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-361s21c1
Sequence:CCGGCCACAAATTGCGGTTGCCAATCTCGAGATTGGCAACCGCAATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-909s21c1
Sequence:CCGGCCTGATTGAATTCGCCAGGAACTCGAGTTCCTGGCGAATTCAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-230s21c1
Sequence:CCGGCCTCCGCTTATGTCAGTACAACTCGAGTTGTACTGACATAAGCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-219s1c1
Sequence:CCGGCCTCCGCTTATGTCAGTACAACTCGAGTTGTACTGACATAAGCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-1120s1c1
Sequence:CCGGCCAAGGGTTACCACAGAACATCTCGAGATGTTCTGTGGTAACCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-898s1c1
Sequence:CCGGCCTGATTGAATTCGCCAGGAACTCGAGTTCCTGGCGAATTCAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-350s1c1
Sequence:CCGGCCACAAATTGCGGTTGCCAATCTCGAGATTGGCAACCGCAATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007408.2-1275s1c1
Sequence:CCGGCCTTAGATGAAGTTATGGATTCTCGAGAATCCATAACTTCATCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007408.3-1286s21c1
Sequence:CCGGCCTTAGATGAAGTTATGGATTCTCGAGAATCCATAACTTCATCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)