EMAIL THIS PAGE TO A FRIEND

PLIN3

perilipin 3

55 Gene Product Result for
Synonyms: M6PRBP1 PP17 TIP47
Gene ID:
Human(10226) Summary: Mannose 6-phophate receptors (MPRs) deliver lysosomal hydrolase from the Golgi to endosomes and then return to the Golgi complex. The protein encoded by this gene interacts with the cytoplasmic domains of both cation-independent and cation-dependent MPRs, and is required for endosome-to-Golgi transport. This protein also binds directly to the GTPase RAB9 (RAB9A), a member of the RAS oncogene family. The interaction with RAB9 has been shown to increase the affinity of this protein for its cargo. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2009]
Mouse(66905) perilipin 3
Rat(316130) perilipin 3
chicken(419149) perilipin 3
dog(485031) perilipin 3
cow(767984) perilipin 3
sheep(100125621) perilipin 3
Goat(100861244) perilipin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005817 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044091 MISSION® esiRNA esiRNA human M6PRBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005817 Rosetta Predictions human pricing
XM_001061015 Rosetta Predictions rat pricing
XM_236783 Rosetta Predictions rat pricing
NM_025836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156487 predicted 1047
2 SASI_Hs01_00156488 predicted 467
3 SASI_Hs02_00340343 predicted 886
4 SASI_Hs01_00156489 predicted 1057
5 SASI_Hs01_00156490 predicted 758
6 SASI_Hs01_00156491 predicted 199
7 SASI_Hs01_00156492 predicted 223
8 SASI_Hs01_00156494 predicted 433
9 SASI_Hs01_00156495 predicted 905
10 SASI_Hs01_00156496 predicted 1284
11 SASI_Hs01_00156493 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298448 predicted 1458
2 SASI_Rn02_00298449 predicted 1665
3 SASI_Rn02_00298450 predicted 1400
4 SASI_Rn02_00298451 predicted 967
5 SASI_Rn02_00298452 predicted 1681
6 SASI_Rn02_00298453 predicted 1333
7 SASI_Rn02_00298454 predicted 1654
8 SASI_Rn02_00298455 predicted 842
9 SASI_Rn02_00298456 predicted 771
10 SASI_Rn02_00298457 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390420 predicted 1463
2 SASI_Rn02_00390421 predicted 1658
3 SASI_Rn02_00390422 predicted 1395
4 SASI_Rn02_00390423 predicted 973
5 SASI_Rn02_00390424 predicted 1674
6 SASI_Rn02_00390425 predicted 1329
7 SASI_Rn02_00390426 predicted 1654
8 SASI_Rn02_00390427 predicted 843
9 SASI_Rn02_00390428 predicted 765
10 SASI_Rn02_00390429 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056260 predicted 657
2 SASI_Mm01_00056262 predicted 1063
3 SASI_Mm01_00056263 predicted 476
4 SASI_Mm01_00056264 predicted 347
5 SASI_Mm01_00056265 predicted 422
6 SASI_Mm01_00056266 predicted 1204
7 SASI_Mm02_00329113 predicted 904
8 SASI_Mm01_00056267 predicted 1245
9 SASI_Mm01_00056268 predicted 753
10 SASI_Mm01_00056269 predicted 586
11 SASI_Mm01_00056261 predicted 254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005817
VALIDATED
PLIN3 MISSION shRNA Bacterial Glycerol Stock
perilipin 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005817.2-1267s1c1
Sequence:CCGGCTGGACCACATGGTGGAATATCTCGAGATATTCCACCATGTGGTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005817.2-329s1c1
Sequence:CCGGAGATTGCATCAGCCAGCGAATCTCGAGATTCGCTGGCTGATGCAATCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005817.2-550s1c1
Sequence:CCGGGTGGACAAGACAAAGTCCGTACTCGAGTACGGACTTTGTCTTGTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005817.2-904s1c1
Sequence:CCGGGAAACTGTCAAGCAAGGCGTTCTCGAGAACGCCTTGCTTGACAGTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005817.2-1044s1c1
Sequence:CCGGGCTCACCATGTTCCGGGACATCTCGAGATGTCCCGGAACATGGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005817.3-911s21c1
Sequence:CCGGGAAACTGTCAAGCAAGGCGTTCTCGAGAACGCCTTGCTTGACAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005817.3-336s21c1
Sequence:CCGGAGATTGCATCAGCCAGCGAATCTCGAGATTCGCTGGCTGATGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005817.3-557s21c1
Sequence:CCGGGTGGACAAGACAAAGTCCGTACTCGAGTACGGACTTTGTCTTGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005817.3-1051s21c1
Sequence:CCGGGCTCACCATGTTCCGGGACATCTCGAGATGTCCCGGAACATGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005817
VALIDATED
PLIN3 MISSION shRNA shRNA Plasmid DNA
perilipin 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005817.2-1267s1c1
Sequence:CCGGCTGGACCACATGGTGGAATATCTCGAGATATTCCACCATGTGGTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005817.2-329s1c1
Sequence:CCGGAGATTGCATCAGCCAGCGAATCTCGAGATTCGCTGGCTGATGCAATCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005817.2-550s1c1
Sequence:CCGGGTGGACAAGACAAAGTCCGTACTCGAGTACGGACTTTGTCTTGTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005817.2-904s1c1
Sequence:CCGGGAAACTGTCAAGCAAGGCGTTCTCGAGAACGCCTTGCTTGACAGTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005817.2-1044s1c1
Sequence:CCGGGCTCACCATGTTCCGGGACATCTCGAGATGTCCCGGAACATGGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005817.3-911s21c1
Sequence:CCGGGAAACTGTCAAGCAAGGCGTTCTCGAGAACGCCTTGCTTGACAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005817.3-336s21c1
Sequence:CCGGAGATTGCATCAGCCAGCGAATCTCGAGATTCGCTGGCTGATGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005817.3-557s21c1
Sequence:CCGGGTGGACAAGACAAAGTCCGTACTCGAGTACGGACTTTGTCTTGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005817.3-1051s21c1
Sequence:CCGGGCTCACCATGTTCCGGGACATCTCGAGATGTCCCGGAACATGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005817
VALIDATED
PLIN3 MISSION shRNA Lentiviral Transduction Particles
perilipin 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005817.2-1267s1c1
Sequence:CCGGCTGGACCACATGGTGGAATATCTCGAGATATTCCACCATGTGGTCCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005817.2-329s1c1
Sequence:CCGGAGATTGCATCAGCCAGCGAATCTCGAGATTCGCTGGCTGATGCAATCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005817.2-550s1c1
Sequence:CCGGGTGGACAAGACAAAGTCCGTACTCGAGTACGGACTTTGTCTTGTCCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005817.2-904s1c1
Sequence:CCGGGAAACTGTCAAGCAAGGCGTTCTCGAGAACGCCTTGCTTGACAGTTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005817.2-1044s1c1
Sequence:CCGGGCTCACCATGTTCCGGGACATCTCGAGATGTCCCGGAACATGGTGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005817.3-911s21c1
Sequence:CCGGGAAACTGTCAAGCAAGGCGTTCTCGAGAACGCCTTGCTTGACAGTTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005817.3-336s21c1
Sequence:CCGGAGATTGCATCAGCCAGCGAATCTCGAGATTCGCTGGCTGATGCAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005817.3-557s21c1
Sequence:CCGGGTGGACAAGACAAAGTCCGTACTCGAGTACGGACTTTGTCTTGTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005817.3-1051s21c1
Sequence:CCGGGCTCACCATGTTCCGGGACATCTCGAGATGTCCCGGAACATGGTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025836
VALIDATED
PLIN3 MISSION shRNA Bacterial Glycerol Stock
perilipin 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025836.1-471s1c1
Sequence:CCGGCTCAAGAAATGGTATCTAGCTCTCGAGAGCTAGATACCATTTCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025836.1-1716s1c1
Sequence:CCGGCACATCACAAATTCAGTGATACTCGAGTATCACTGAATTTGTGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025836.1-1715s1c1
Sequence:CCGGCCACATCACAAATTCAGTGATCTCGAGATCACTGAATTTGTGATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025836.3-626s21c1
Sequence:CCGGGTGTGGGACAGATGGTGATTACTCGAGTAATCACCATCTGTCCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025836.3-823s21c1
Sequence:CCGGCTGCGCAATCACGCCTATGAACTCGAGTTCATAGGCGTGATTGCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025836.3-1706s21c1
Sequence:CCGGCCGGCTGCCACATCACAAATTCTCGAGAATTTGTGATGTGGCAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025836.3-917s21c1
Sequence:CCGGGCCTGATGGAATCCGTGAAACCTCGAGGTTTCACGGATTCCATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025836.3-776s21c1
Sequence:CCGGGACAGGAGCAGAACTACTTTGCTCGAGCAAAGTAGTTCTGCTCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025836
VALIDATED
PLIN3 MISSION shRNA shRNA Plasmid DNA
perilipin 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025836.1-471s1c1
Sequence:CCGGCTCAAGAAATGGTATCTAGCTCTCGAGAGCTAGATACCATTTCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025836.1-1716s1c1
Sequence:CCGGCACATCACAAATTCAGTGATACTCGAGTATCACTGAATTTGTGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025836.1-1715s1c1
Sequence:CCGGCCACATCACAAATTCAGTGATCTCGAGATCACTGAATTTGTGATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025836.3-626s21c1
Sequence:CCGGGTGTGGGACAGATGGTGATTACTCGAGTAATCACCATCTGTCCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025836.3-823s21c1
Sequence:CCGGCTGCGCAATCACGCCTATGAACTCGAGTTCATAGGCGTGATTGCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025836.3-1706s21c1
Sequence:CCGGCCGGCTGCCACATCACAAATTCTCGAGAATTTGTGATGTGGCAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025836.3-917s21c1
Sequence:CCGGGCCTGATGGAATCCGTGAAACCTCGAGGTTTCACGGATTCCATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025836.3-776s21c1
Sequence:CCGGGACAGGAGCAGAACTACTTTGCTCGAGCAAAGTAGTTCTGCTCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025836
VALIDATED
PLIN3 MISSION shRNA Lentiviral Transduction Particles
perilipin 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025836.1-471s1c1
Sequence:CCGGCTCAAGAAATGGTATCTAGCTCTCGAGAGCTAGATACCATTTCTTGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025836.1-1716s1c1
Sequence:CCGGCACATCACAAATTCAGTGATACTCGAGTATCACTGAATTTGTGATGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025836.1-1715s1c1
Sequence:CCGGCCACATCACAAATTCAGTGATCTCGAGATCACTGAATTTGTGATGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025836.3-626s21c1
Sequence:CCGGGTGTGGGACAGATGGTGATTACTCGAGTAATCACCATCTGTCCCACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025836.3-823s21c1
Sequence:CCGGCTGCGCAATCACGCCTATGAACTCGAGTTCATAGGCGTGATTGCGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025836.3-1706s21c1
Sequence:CCGGCCGGCTGCCACATCACAAATTCTCGAGAATTTGTGATGTGGCAGCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025836.3-917s21c1
Sequence:CCGGGCCTGATGGAATCCGTGAAACCTCGAGGTTTCACGGATTCCATCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025836.3-776s21c1
Sequence:CCGGGACAGGAGCAGAACTACTTTGCTCGAGCAAAGTAGTTCTGCTCCTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)