EMAIL THIS PAGE TO A FRIEND

PLIN4

perilipin 4

40 Gene Product Result for
Synonyms: KIAA1881 S3-12
UniProtKB ID: Q96Q06, A6NEI2
Gene ID:
Human(729359) Summary: Members of the perilipin family, such as PLIN4, coat intracellular lipid storage droplets (Wolins et al., 2003 [PubMed 12840023]
Mouse(57435) perilipin 4
Rat(363331) perilipin 4
cow(510990) perilipin 4
sheep(101114356) perilipin 4
dog(491467) perilipin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080400 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080400 Rosetta Predictions human pricing
XM_343669 Rosetta Predictions rat pricing
NM_020568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314491 predicted 1043
2 SASI_Hs02_00314492 predicted 2072
3 SASI_Hs02_00314493 predicted 733
4 SASI_Hs02_00314494 predicted 3527
5 SASI_Hs02_00314495 predicted 591
6 SASI_Hs02_00314496 predicted 708
7 SASI_Hs02_00314497 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00129493 predicted 370
2 SASI_Rn01_00129494 predicted 314
3 SASI_Rn01_00129495 predicted 915
4 SASI_Rn01_00129496 predicted 129
5 SASI_Rn01_00129497 predicted 58
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136793 predicted 3039
2 SASI_Mm01_00136794 predicted 3437
3 SASI_Mm01_00136795 predicted 2523
4 SASI_Mm02_00325619 predicted 3697
5 SASI_Mm01_00136796 predicted 2448
6 SASI_Mm01_00136797 predicted 4423
7 SASI_Mm01_00136798 predicted 4177
8 SASI_Mm01_00136800 predicted 3082
9 SASI_Mm01_00136801 predicted 3298
10 SASI_Mm01_00136802 predicted 3968
11 SASI_Mm01_00136799 predicted 3425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020568
VALIDATED
PLIN4 MISSION shRNA Bacterial Glycerol Stock
perilipin 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020568.3-261s21c1
Sequence:CCGGCAAAGGACTTACAAACAGCAACTCGAGTTGCTGTTTGTAAGTCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020568.3-5356s21c1
Sequence:CCGGGCCAAGTTATTGGTGGCTATTCTCGAGAATAGCCACCAATAACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020568.3-1005s21c1
Sequence:CCGGCTGGCACAAAGGACACTGTATCTCGAGATACAGTGTCCTTTGTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020568.3-598s21c1
Sequence:CCGGGAATGTCCTCACCAATACGAACTCGAGTTCGTATTGGTGAGGACATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020568.1-1313s1c1
Sequence:CCGGCTGGCACAAAGGACACTGTATCTCGAGATACAGTGTCCTTTGTGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020568.1-609s1c1
Sequence:CCGGGAATGTCCTCACCAATACGAACTCGAGTTCGTATTGGTGAGGACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020568.1-5372s1c1
Sequence:CCGGGCCAAGTTATTGGTGGCTATTCTCGAGAATAGCCACCAATAACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020568.1-272s1c1
Sequence:CCGGCAAAGGACTTACAAACAGCAACTCGAGTTGCTGTTTGTAAGTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020568.1-1841s1c1
Sequence:CCGGCAGGAGCCATTAATGTGGCTACTCGAGTAGCCACATTAATGGCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020568
VALIDATED
PLIN4 MISSION shRNA shRNA Plasmid DNA
perilipin 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020568.3-261s21c1
Sequence:CCGGCAAAGGACTTACAAACAGCAACTCGAGTTGCTGTTTGTAAGTCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020568.3-5356s21c1
Sequence:CCGGGCCAAGTTATTGGTGGCTATTCTCGAGAATAGCCACCAATAACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020568.3-1005s21c1
Sequence:CCGGCTGGCACAAAGGACACTGTATCTCGAGATACAGTGTCCTTTGTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020568.3-598s21c1
Sequence:CCGGGAATGTCCTCACCAATACGAACTCGAGTTCGTATTGGTGAGGACATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020568.1-1313s1c1
Sequence:CCGGCTGGCACAAAGGACACTGTATCTCGAGATACAGTGTCCTTTGTGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020568.1-609s1c1
Sequence:CCGGGAATGTCCTCACCAATACGAACTCGAGTTCGTATTGGTGAGGACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020568.1-5372s1c1
Sequence:CCGGGCCAAGTTATTGGTGGCTATTCTCGAGAATAGCCACCAATAACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020568.1-272s1c1
Sequence:CCGGCAAAGGACTTACAAACAGCAACTCGAGTTGCTGTTTGTAAGTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020568.1-1841s1c1
Sequence:CCGGCAGGAGCCATTAATGTGGCTACTCGAGTAGCCACATTAATGGCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020568
VALIDATED
PLIN4 MISSION shRNA Lentiviral Transduction Particles
perilipin 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020568.3-261s21c1
Sequence:CCGGCAAAGGACTTACAAACAGCAACTCGAGTTGCTGTTTGTAAGTCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020568.3-5356s21c1
Sequence:CCGGGCCAAGTTATTGGTGGCTATTCTCGAGAATAGCCACCAATAACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020568.3-1005s21c1
Sequence:CCGGCTGGCACAAAGGACACTGTATCTCGAGATACAGTGTCCTTTGTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020568.3-598s21c1
Sequence:CCGGGAATGTCCTCACCAATACGAACTCGAGTTCGTATTGGTGAGGACATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020568.1-1313s1c1
Sequence:CCGGCTGGCACAAAGGACACTGTATCTCGAGATACAGTGTCCTTTGTGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020568.1-609s1c1
Sequence:CCGGGAATGTCCTCACCAATACGAACTCGAGTTCGTATTGGTGAGGACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020568.1-5372s1c1
Sequence:CCGGGCCAAGTTATTGGTGGCTATTCTCGAGAATAGCCACCAATAACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020568.1-272s1c1
Sequence:CCGGCAAAGGACTTACAAACAGCAACTCGAGTTGCTGTTTGTAAGTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020568.1-1841s1c1
Sequence:CCGGCAGGAGCCATTAATGTGGCTACTCGAGTAGCCACATTAATGGCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080400
PLIN4 MISSION shRNA Bacterial Glycerol Stock
perilipin 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080400.1-3523s21c1
Sequence:CCGGGGGAGCTACTTCGTTCGTTTACTCGAGTAAACGAACGAAGTAGCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080400.1-4580s21c1
Sequence:CCGGCACACACCTTGAGGGTCTTAACTCGAGTTAAGACCCTCAAGGTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080400.1-1326s21c1
Sequence:CCGGCACCACCAAGATCGTTCTAACCTCGAGGTTAGAACGATCTTGGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080400.1-2759s21c1
Sequence:CCGGGAGTCACTGGTGCCGTAAATGCTCGAGCATTTACGGCACCAGTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080400.1-1436s21c1
Sequence:CCGGCTGTCCTGACTGGCACTAAAGCTCGAGCTTTAGTGCCAGTCAGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080400
PLIN4 MISSION shRNA shRNA Plasmid DNA
perilipin 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080400.1-3523s21c1
Sequence:CCGGGGGAGCTACTTCGTTCGTTTACTCGAGTAAACGAACGAAGTAGCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080400.1-4580s21c1
Sequence:CCGGCACACACCTTGAGGGTCTTAACTCGAGTTAAGACCCTCAAGGTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080400.1-1326s21c1
Sequence:CCGGCACCACCAAGATCGTTCTAACCTCGAGGTTAGAACGATCTTGGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080400.1-2759s21c1
Sequence:CCGGGAGTCACTGGTGCCGTAAATGCTCGAGCATTTACGGCACCAGTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080400.1-1436s21c1
Sequence:CCGGCTGTCCTGACTGGCACTAAAGCTCGAGCTTTAGTGCCAGTCAGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080400
PLIN4 MISSION shRNA Lentiviral Transduction Particles
perilipin 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080400.1-3523s21c1
Sequence:CCGGGGGAGCTACTTCGTTCGTTTACTCGAGTAAACGAACGAAGTAGCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080400.1-4580s21c1
Sequence:CCGGCACACACCTTGAGGGTCTTAACTCGAGTTAAGACCCTCAAGGTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080400.1-1326s21c1
Sequence:CCGGCACCACCAAGATCGTTCTAACCTCGAGGTTAGAACGATCTTGGTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080400.1-2759s21c1
Sequence:CCGGGAGTCACTGGTGCCGTAAATGCTCGAGCATTTACGGCACCAGTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080400.1-1436s21c1
Sequence:CCGGCTGTCCTGACTGGCACTAAAGCTCGAGCTTTAGTGCCAGTCAGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)