EMAIL THIS PAGE TO A FRIEND

PLK1

polo-like kinase 1

107 Gene Product Result for
Synonyms: PLK STPK13
UniProtKB ID: P53350, Q15153, Q99746
Gene ID:
Mouse(18817) polo-like kinase 1
Rat(25515) polo-like kinase 1
cow(538238) polo-like kinase 1
sheep(101105713) polo-like kinase 1
naked mole-rat(101721399) polo-like kinase 1
domestic guinea pig(100716866) polo-like kinase 1
Zebrafish(280649) polo-like kinase 1 (Drosophila)
domestic cat(101098508) polo-like kinase 1
dog(489971) polo-like kinase 1
chicken(416575) polo-like kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504640 Anti-phospho-PLK1 (pSer137) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4503974 Anti-phospho-PLK1 (pThr210) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB2108702 Anti-PLK1 affinity isolated antibody pig, mouse, guinea pig, rat, canine, horse, human, bovine
immunohistochemistry, western blot pricing
K2142 Anti-PLK1 (448-460) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1406265 Anti-PLK1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2101829 Anti-PLK1 antibody produced in rabbit affinity isolated antibody mouse, rabbit, horse, guinea pig, human, canine, rat, bovine
western blot pricing
HPA051638 Anti-PLK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA053229 Anti-PLK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4502211 Anti-PLK1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
P5998 Monoclonal Anti-hPlk1 (Polo Like Kinase 1) antibody produced in mouse ~2 mg/mL, clone 35-206, purified immunoglobulin, buffered aqueous solution rat, human, mouse
immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing
WH0005347M1 Monoclonal Anti-PLK1 antibody produced in mouse clone 2G12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), proximity ligation assay, western blot pricing
SAB1404220 Monoclonal Anti-PLK1 antibody produced in mouse clone 4G11, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, western blot pricing
PLA0073 Rabbit anti-PLK1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rabbit, marmoset, gibbon, human, gorilla, chimpanzee
immunofluorescence, immunoprecipitation (IP), proximity ligation assay, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0100 AQUA Peptide (pS)LLELH[K] African clawed frog, chicken, cow, dog, human, mouse, pig, rat pricing
AQ0030 AQUA Peptide IGDFGLAT[K] African clawed frog, chicken, cow, dog, human, mouse, pig, rat pricing
AQ0029 AQUA Peptide HINPVAASLIQ[K] dog, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005030 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011121 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011121 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011121 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005030 siRNAs that have been validated in the lab human pricing
NM_017100 Rosetta Predictions rat pricing
NM_011121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005030 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194343 validated 1844
2 SASI_Hs01_00194345 predicted 1493
3 SASI_Hs01_00194346 predicted 763
4 SASI_Hs01_00194347 predicted 637
5 SASI_Hs01_00194348 predicted 715
6 SASI_Hs02_00338814 predicted 832
7 SASI_Hs01_00194349 predicted 1480
8 SASI_Hs02_00338815 predicted 558
9 SASI_Hs01_00194350 predicted 1301
10 SASI_Hs01_00194351 predicted 508
11 SASI_Hs01_00194344 predicted 837
12 SASI_Hs01_00194352 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078485 predicted 1773
2 SASI_Rn01_00078486 predicted 621
3 SASI_Rn01_00078487 predicted 996
4 SASI_Rn01_00078488 predicted 548
5 SASI_Rn01_00078489 predicted 1535
6 SASI_Rn01_00078490 predicted 1312
7 SASI_Rn01_00078491 predicted 1303
8 SASI_Rn01_00078492 predicted 1619
9 SASI_Rn01_00078493 predicted 1317
10 SASI_Rn01_00078494 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072214 predicted 1376
2 SASI_Mm01_00072216 predicted 695
3 SASI_Mm01_00072217 predicted 1635
4 SASI_Mm02_00319935 predicted 306
5 SASI_Mm02_00319936 predicted 1503
6 SASI_Mm01_00072218 predicted 359
7 SASI_Mm01_00072220 predicted 465
8 SASI_Mm01_00072221 predicted 1544
9 SASI_Mm01_00072222 predicted 985
10 SASI_Mm02_00319937 predicted 1523
11 SASI_Mm01_00072215 predicted 2134
12 SASI_Mm01_00072219 predicted 759
13 SASI_Mm01_00072223 predicted 1574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005030
VALIDATED
PLK1 MISSION shRNA Bacterial Glycerol Stock
polo-like kinase 1
Human
26 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005030.3-962s21c1
Sequence:CCGGGTTCTTTACTTCTGGCTATATCTCGAGATATAGCCAGAAGTAAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005030.3-944s21c1
Sequence:CCGGCGAGCTGCTTAATGACGAGTTCTCGAGAACTCGTCATTAAGCAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005030.3-711s21c1
Sequence:CCGGCCCGAGGTGCTGAGCAAGAAACTCGAGTTTCTTGCTCAGCACCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005030.3-1673s21c1
Sequence:CCGGGCTCATCTTGTGCCCACTGATCTCGAGATCAGTGGGCACAAGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-291s1c1
Sequence:CCGGGCGGGCAAGATTGTGCCTAAGCTCGAGCTTAGGCACAATCTTGCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005030.3-390s1c1
Sequence:CCGGGTCGTAGGATTCCACGGCTTTCTCGAGAAAGCCGTGGAATCCTACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-769s1c1
Sequence:CCGGGTATCATGTATACCTTGTTAGCTCGAGCTAACAAGGTATACATGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-242s1c1
Sequence:CCGGCTTTGCCAAGTGCTTCGAGATCTCGAGATCTCGAAGCACTTGGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1718s1c1
Sequence:CCGGGAAGCGGGACTTCCGCACATACTCGAGTATGTGCGGAAGTCCCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1986s1c1
Sequence:CCGGAGCTGCATCATCCTTGCAGGTCTCGAGACCTGCAAGGATGATGCAGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-933s1c1
Sequence:CCGGCCAACCATTAACGAGCTGCTTCTCGAGAAGCAGCTCGTTAATGGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005030.3-836s1c1
Sequence:CCGGCCGGATCAAGAAGAATGAATACTCGAGTATTCATTCTTCTTGATCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1374s1c1
Sequence:CCGGCGCCTCATCCTCTACAATGATCTCGAGATCATTGTAGAGGATGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-513s1c1
Sequence:CCGGCGATACTACCTACGGCAAATTCTCGAGAATTTGCCGTAGGTAGTATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-326s1c1
Sequence:CCGGGCCGCACCAGAGGGAGAAGATCTCGAGATCTTCTCCCTCTGGTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1073s1c1
Sequence:CCGGCACAGTCCTCAATAAAGGCTTCTCGAGAAGCCTTTATTGAGGACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005030.3-711s1c1
Sequence:CCGGCCCGAGGTGCTGAGCAAGAAACTCGAGTTTCTTGCTCAGCACCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-722s1c1
Sequence:CCGGGAGCAAGAAAGGGCACAGTTTCTCGAGAAACTGTGCCCTTTCTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005030.3-1673s1c1
Sequence:CCGGGCTCATCTTGTGCCCACTGATCTCGAGATCAGTGGGCACAAGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-962s1c1
Sequence:CCGGGTTCTTTACTTCTGGCTATATCTCGAGATATAGCCAGAAGTAAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005030.3-1361s1c1
Sequence:CCGGCAATGACTCAACACGCCTCATCTCGAGATGAGGCGTGTTGAGTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1893s1c1
Sequence:CCGGCCTCCTCACTCCCACCTGCATCTCGAGATGCAGGTGGGAGTGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1644s1c1
Sequence:CCGGCAGATCAACTTCTTCCAGGATCTCGAGATCCTGGAAGAAGTTGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1008s1c1
Sequence:CCGGCTGACCATTCCACCAAGGTTTCTCGAGAAACCTTGGTGGAATGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-552s1c1
Sequence:CCGGCTGCACCGAAACCGAGTTATTCTCGAGAATAACTCGGTTTCGGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-2044s1c1
Sequence:CCGGGTGTGGGTTCTACAGCCTTGTCTCGAGACAAGGCTGTAGAACCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005030
VALIDATED
PLK1 MISSION shRNA shRNA Plasmid DNA
polo-like kinase 1
Human
26 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005030.3-962s21c1
Sequence:CCGGGTTCTTTACTTCTGGCTATATCTCGAGATATAGCCAGAAGTAAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005030.3-944s21c1
Sequence:CCGGCGAGCTGCTTAATGACGAGTTCTCGAGAACTCGTCATTAAGCAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005030.3-711s21c1
Sequence:CCGGCCCGAGGTGCTGAGCAAGAAACTCGAGTTTCTTGCTCAGCACCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005030.3-1673s21c1
Sequence:CCGGGCTCATCTTGTGCCCACTGATCTCGAGATCAGTGGGCACAAGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-291s1c1
Sequence:CCGGGCGGGCAAGATTGTGCCTAAGCTCGAGCTTAGGCACAATCTTGCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005030.3-390s1c1
Sequence:CCGGGTCGTAGGATTCCACGGCTTTCTCGAGAAAGCCGTGGAATCCTACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-769s1c1
Sequence:CCGGGTATCATGTATACCTTGTTAGCTCGAGCTAACAAGGTATACATGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-242s1c1
Sequence:CCGGCTTTGCCAAGTGCTTCGAGATCTCGAGATCTCGAAGCACTTGGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1718s1c1
Sequence:CCGGGAAGCGGGACTTCCGCACATACTCGAGTATGTGCGGAAGTCCCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1986s1c1
Sequence:CCGGAGCTGCATCATCCTTGCAGGTCTCGAGACCTGCAAGGATGATGCAGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-933s1c1
Sequence:CCGGCCAACCATTAACGAGCTGCTTCTCGAGAAGCAGCTCGTTAATGGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005030.3-836s1c1
Sequence:CCGGCCGGATCAAGAAGAATGAATACTCGAGTATTCATTCTTCTTGATCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1374s1c1
Sequence:CCGGCGCCTCATCCTCTACAATGATCTCGAGATCATTGTAGAGGATGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-513s1c1
Sequence:CCGGCGATACTACCTACGGCAAATTCTCGAGAATTTGCCGTAGGTAGTATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-326s1c1
Sequence:CCGGGCCGCACCAGAGGGAGAAGATCTCGAGATCTTCTCCCTCTGGTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1073s1c1
Sequence:CCGGCACAGTCCTCAATAAAGGCTTCTCGAGAAGCCTTTATTGAGGACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005030.3-711s1c1
Sequence:CCGGCCCGAGGTGCTGAGCAAGAAACTCGAGTTTCTTGCTCAGCACCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-722s1c1
Sequence:CCGGGAGCAAGAAAGGGCACAGTTTCTCGAGAAACTGTGCCCTTTCTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005030.3-1673s1c1
Sequence:CCGGGCTCATCTTGTGCCCACTGATCTCGAGATCAGTGGGCACAAGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-962s1c1
Sequence:CCGGGTTCTTTACTTCTGGCTATATCTCGAGATATAGCCAGAAGTAAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005030.3-1361s1c1
Sequence:CCGGCAATGACTCAACACGCCTCATCTCGAGATGAGGCGTGTTGAGTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1893s1c1
Sequence:CCGGCCTCCTCACTCCCACCTGCATCTCGAGATGCAGGTGGGAGTGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1644s1c1
Sequence:CCGGCAGATCAACTTCTTCCAGGATCTCGAGATCCTGGAAGAAGTTGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1008s1c1
Sequence:CCGGCTGACCATTCCACCAAGGTTTCTCGAGAAACCTTGGTGGAATGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-552s1c1
Sequence:CCGGCTGCACCGAAACCGAGTTATTCTCGAGAATAACTCGGTTTCGGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-2044s1c1
Sequence:CCGGGTGTGGGTTCTACAGCCTTGTCTCGAGACAAGGCTGTAGAACCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005030
VALIDATED
PLK1 MISSION shRNA Lentiviral Transduction Particles
polo-like kinase 1
Human
26 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005030.3-962s21c1
Sequence:CCGGGTTCTTTACTTCTGGCTATATCTCGAGATATAGCCAGAAGTAAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005030.3-944s21c1
Sequence:CCGGCGAGCTGCTTAATGACGAGTTCTCGAGAACTCGTCATTAAGCAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005030.3-711s21c1
Sequence:CCGGCCCGAGGTGCTGAGCAAGAAACTCGAGTTTCTTGCTCAGCACCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005030.3-1673s21c1
Sequence:CCGGGCTCATCTTGTGCCCACTGATCTCGAGATCAGTGGGCACAAGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-291s1c1
Sequence:CCGGGCGGGCAAGATTGTGCCTAAGCTCGAGCTTAGGCACAATCTTGCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005030.3-390s1c1
Sequence:CCGGGTCGTAGGATTCCACGGCTTTCTCGAGAAAGCCGTGGAATCCTACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-769s1c1
Sequence:CCGGGTATCATGTATACCTTGTTAGCTCGAGCTAACAAGGTATACATGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-242s1c1
Sequence:CCGGCTTTGCCAAGTGCTTCGAGATCTCGAGATCTCGAAGCACTTGGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1718s1c1
Sequence:CCGGGAAGCGGGACTTCCGCACATACTCGAGTATGTGCGGAAGTCCCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1986s1c1
Sequence:CCGGAGCTGCATCATCCTTGCAGGTCTCGAGACCTGCAAGGATGATGCAGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-933s1c1
Sequence:CCGGCCAACCATTAACGAGCTGCTTCTCGAGAAGCAGCTCGTTAATGGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005030.3-836s1c1
Sequence:CCGGCCGGATCAAGAAGAATGAATACTCGAGTATTCATTCTTCTTGATCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1374s1c1
Sequence:CCGGCGCCTCATCCTCTACAATGATCTCGAGATCATTGTAGAGGATGAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-513s1c1
Sequence:CCGGCGATACTACCTACGGCAAATTCTCGAGAATTTGCCGTAGGTAGTATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-326s1c1
Sequence:CCGGGCCGCACCAGAGGGAGAAGATCTCGAGATCTTCTCCCTCTGGTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1073s1c1
Sequence:CCGGCACAGTCCTCAATAAAGGCTTCTCGAGAAGCCTTTATTGAGGACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005030.3-711s1c1
Sequence:CCGGCCCGAGGTGCTGAGCAAGAAACTCGAGTTTCTTGCTCAGCACCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-722s1c1
Sequence:CCGGGAGCAAGAAAGGGCACAGTTTCTCGAGAAACTGTGCCCTTTCTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005030.3-1673s1c1
Sequence:CCGGGCTCATCTTGTGCCCACTGATCTCGAGATCAGTGGGCACAAGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-962s1c1
Sequence:CCGGGTTCTTTACTTCTGGCTATATCTCGAGATATAGCCAGAAGTAAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005030.3-1361s1c1
Sequence:CCGGCAATGACTCAACACGCCTCATCTCGAGATGAGGCGTGTTGAGTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1893s1c1
Sequence:CCGGCCTCCTCACTCCCACCTGCATCTCGAGATGCAGGTGGGAGTGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1644s1c1
Sequence:CCGGCAGATCAACTTCTTCCAGGATCTCGAGATCCTGGAAGAAGTTGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-1008s1c1
Sequence:CCGGCTGACCATTCCACCAAGGTTTCTCGAGAAACCTTGGTGGAATGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-552s1c1
Sequence:CCGGCTGCACCGAAACCGAGTTATTCTCGAGAATAACTCGGTTTCGGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005030.3-2044s1c1
Sequence:CCGGGTGTGGGTTCTACAGCCTTGTCTCGAGACAAGGCTGTAGAACCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011121
VALIDATED
PLK1 MISSION shRNA Bacterial Glycerol Stock
polo-like kinase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011121.3-1338s21c1
Sequence:CCGGTCAGCAAGTGGGTGGACTATTCTCGAGAATAGTCCACCCACTTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011121.3-567s21c1
Sequence:CCGGGCTACTACCTGCGACAGATAGCTCGAGCTATCTGTCGCAGGTAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011121.3-1711s21c1
Sequence:CCGGCCAGGACCACACCAAACTTATCTCGAGATAAGTTTGGTGTGGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011121.3-1944s21c1
Sequence:CCGGCTTCACTCTGCTAGCTCTGAGCTCGAGCTCAGAGCTAGCAGAGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011121.3-1416s21c1
Sequence:CCGGATGACTCAACACGCCTGATTCCTCGAGGAATCAGGCGTGTTGAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011121.2-2074s1c1
Sequence:CCGGCCAGGACCACACCAAACTTATCTCGAGATAAGTTTGGTGTGGTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011121.2-1484s1c1
Sequence:CCGGCCTCTCAAAGTCCTCAATAAACTCGAGTTTATTGAGGACTTTGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011121.2-1061s1c1
Sequence:CCGGGCAACCAAAGTGGAATATGAACTCGAGTTCATATTCCACTTTGGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011121.2-1903s1c1
Sequence:CCGGCCTCAACTATTTCCGCAATTACTCGAGTAATTGCGGAAATAGTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011121.2-658s1c1
Sequence:CCGGCTTCGCCAAATGCTTCGAGATCTCGAGATCTCGAAGCATTTGGCGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011121
VALIDATED
PLK1 MISSION shRNA shRNA Plasmid DNA
polo-like kinase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011121.3-1338s21c1
Sequence:CCGGTCAGCAAGTGGGTGGACTATTCTCGAGAATAGTCCACCCACTTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011121.3-567s21c1
Sequence:CCGGGCTACTACCTGCGACAGATAGCTCGAGCTATCTGTCGCAGGTAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011121.3-1711s21c1
Sequence:CCGGCCAGGACCACACCAAACTTATCTCGAGATAAGTTTGGTGTGGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011121.3-1944s21c1
Sequence:CCGGCTTCACTCTGCTAGCTCTGAGCTCGAGCTCAGAGCTAGCAGAGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011121.3-1416s21c1
Sequence:CCGGATGACTCAACACGCCTGATTCCTCGAGGAATCAGGCGTGTTGAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011121.2-2074s1c1
Sequence:CCGGCCAGGACCACACCAAACTTATCTCGAGATAAGTTTGGTGTGGTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011121.2-1484s1c1
Sequence:CCGGCCTCTCAAAGTCCTCAATAAACTCGAGTTTATTGAGGACTTTGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011121.2-1061s1c1
Sequence:CCGGGCAACCAAAGTGGAATATGAACTCGAGTTCATATTCCACTTTGGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011121.2-1903s1c1
Sequence:CCGGCCTCAACTATTTCCGCAATTACTCGAGTAATTGCGGAAATAGTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011121.2-658s1c1
Sequence:CCGGCTTCGCCAAATGCTTCGAGATCTCGAGATCTCGAAGCATTTGGCGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011121
VALIDATED
PLK1 MISSION shRNA Lentiviral Transduction Particles
polo-like kinase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011121.3-1338s21c1
Sequence:CCGGTCAGCAAGTGGGTGGACTATTCTCGAGAATAGTCCACCCACTTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011121.3-567s21c1
Sequence:CCGGGCTACTACCTGCGACAGATAGCTCGAGCTATCTGTCGCAGGTAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011121.3-1711s21c1
Sequence:CCGGCCAGGACCACACCAAACTTATCTCGAGATAAGTTTGGTGTGGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011121.3-1944s21c1
Sequence:CCGGCTTCACTCTGCTAGCTCTGAGCTCGAGCTCAGAGCTAGCAGAGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011121.3-1416s21c1
Sequence:CCGGATGACTCAACACGCCTGATTCCTCGAGGAATCAGGCGTGTTGAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011121.2-2074s1c1
Sequence:CCGGCCAGGACCACACCAAACTTATCTCGAGATAAGTTTGGTGTGGTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011121.2-1484s1c1
Sequence:CCGGCCTCTCAAAGTCCTCAATAAACTCGAGTTTATTGAGGACTTTGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011121.2-1061s1c1
Sequence:CCGGGCAACCAAAGTGGAATATGAACTCGAGTTCATATTCCACTTTGGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011121.2-1903s1c1
Sequence:CCGGCCTCAACTATTTCCGCAATTACTCGAGTAATTGCGGAAATAGTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011121.2-658s1c1
Sequence:CCGGCTTCGCCAAATGCTTCGAGATCTCGAGATCTCGAAGCATTTGGCGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)