EMAIL THIS PAGE TO A FRIEND

PLK3

polo-like kinase 3

124 Gene Product Result for
Synonyms: CNK FNK PRK
UniProtKB ID: Q9H4B4, Q15767, Q5JR99, Q96CV1
Gene ID:
Human(1263) Summary: Cytokine-inducible kinase is a putative serine/threonine kinase. CNK contains both a catalytic domain and a putative regulatory domain. It may play a role in regulation of cell cycle progression and tumorigenesis. [provided by RefSeq, Jul 2008]
Mouse(12795) polo-like kinase 3
Rat(58936) polo-like kinase 3
Zebrafish(334202) polo-like kinase 3 (Drosophila)
dog(475380) polo-like kinase 3
domestic cat(101088599) polo-like kinase 3
Horse(100065793) polo-like kinase 3
chicken(424586) polo-like kinase 3
domestic guinea pig(100722765) polo-like kinase 3
naked mole-rat(101702778) polo-like kinase 3
Domestic Rabbit(100349159) polo-like kinase 3
cow(504282) polo-like kinase 3
sheep(101109760) polo-like kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004073 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004073 Rosetta Predictions human pricing
XM_001071757 Rosetta Predictions rat pricing
XM_342888 Rosetta Predictions rat pricing
NM_013807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166384 predicted 910
2 SASI_Hs01_00166385 predicted 404
3 SASI_Hs01_00166386 predicted 1598
4 SASI_Hs01_00166387 predicted 582
5 SASI_Hs01_00166388 predicted 1577
6 SASI_Hs01_00166389 predicted 1815
7 SASI_Hs01_00166390 predicted 1067
8 SASI_Hs01_00166391 predicted 1603
9 SASI_Hs01_00166392 predicted 1410
10 SASI_Hs01_00166393 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336359 predicted 640
2 SASI_Rn02_00336360 predicted 959
3 SASI_Rn02_00336361 predicted 738
4 SASI_Rn02_00336362 predicted 463
5 SASI_Rn02_00336363 predicted 704
6 SASI_Rn02_00336364 predicted 1467
7 SASI_Rn02_00336365 predicted 1918
8 SASI_Rn02_00336366 predicted 1419
9 SASI_Rn02_00336367 predicted 1970
10 SASI_Rn02_00336368 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394961 predicted 633
2 SASI_Rn02_00394962 predicted 485
3 SASI_Rn02_00394963 predicted 633
4 SASI_Rn02_00394964 predicted 564
5 SASI_Rn02_00394965 predicted 722
6 SASI_Rn02_00394966 predicted 488
7 SASI_Rn02_00394967 predicted 633
8 SASI_Rn02_00394968 predicted 554
9 SASI_Rn02_00394969 predicted 580
10 SASI_Rn02_00394970 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045622 predicted 666
2 SASI_Mm01_00045623 predicted 642
3 SASI_Mm01_00045624 predicted 885
4 SASI_Mm01_00045625 predicted 1405
5 SASI_Mm01_00045626 predicted 1409
6 SASI_Mm01_00045627 predicted 757
7 SASI_Mm01_00045628 predicted 520
8 SASI_Mm01_00045629 predicted 752
9 SASI_Mm01_00045630 predicted 1587
10 SASI_Mm01_00045631 predicted 1346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013807
VALIDATED
PLK3 MISSION shRNA Bacterial Glycerol Stock
polo-like kinase 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013807.1-892s1c1
Sequence:CCGGGCTGCATCAAGCAGGTTCATTCTCGAGAATGAACCTGCTTGATGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013807.1-1488s1c1
Sequence:CCGGGTTGACTACTCCAACAAGTTTCTCGAGAAACTTGTTGGAGTAGTCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013807.1-474s1c1
Sequence:CCGGGATGCTGACAACATATACATTCTCGAGAATGTATATGTTGTCAGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013807.1-662s1c1
Sequence:CCGGCACGGATAACATGGAACTGAACTCGAGTTCAGTTCCATGTTATCCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013807.1-1118s1c1
Sequence:CCGGCAAAGTTACCAAGAGCCTGTTCTCGAGAACAGGCTCTTGGTAACTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013807.2-397s21c1
Sequence:CCGGTCAGCGCGAGAAGATCCTAAACTCGAGTTTAGGATCTTCTCGCGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013807.2-477s21c1
Sequence:CCGGTCGAGGATGCTGACAACATATCTCGAGATATGTTGTCAGCATCCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013807.2-345s21c1
Sequence:CCGGGTATAGCCTACGCGGTCAAAGCTCGAGCTTTGACCGCGTAGGCTATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013807
VALIDATED
PLK3 MISSION shRNA shRNA Plasmid DNA
polo-like kinase 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013807.1-892s1c1
Sequence:CCGGGCTGCATCAAGCAGGTTCATTCTCGAGAATGAACCTGCTTGATGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013807.1-1488s1c1
Sequence:CCGGGTTGACTACTCCAACAAGTTTCTCGAGAAACTTGTTGGAGTAGTCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013807.1-474s1c1
Sequence:CCGGGATGCTGACAACATATACATTCTCGAGAATGTATATGTTGTCAGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013807.1-662s1c1
Sequence:CCGGCACGGATAACATGGAACTGAACTCGAGTTCAGTTCCATGTTATCCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013807.1-1118s1c1
Sequence:CCGGCAAAGTTACCAAGAGCCTGTTCTCGAGAACAGGCTCTTGGTAACTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013807.2-397s21c1
Sequence:CCGGTCAGCGCGAGAAGATCCTAAACTCGAGTTTAGGATCTTCTCGCGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013807.2-477s21c1
Sequence:CCGGTCGAGGATGCTGACAACATATCTCGAGATATGTTGTCAGCATCCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013807.2-345s21c1
Sequence:CCGGGTATAGCCTACGCGGTCAAAGCTCGAGCTTTGACCGCGTAGGCTATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013807
VALIDATED
PLK3 MISSION shRNA Lentiviral Transduction Particles
polo-like kinase 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013807.1-892s1c1
Sequence:CCGGGCTGCATCAAGCAGGTTCATTCTCGAGAATGAACCTGCTTGATGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013807.1-1488s1c1
Sequence:CCGGGTTGACTACTCCAACAAGTTTCTCGAGAAACTTGTTGGAGTAGTCAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013807.1-474s1c1
Sequence:CCGGGATGCTGACAACATATACATTCTCGAGAATGTATATGTTGTCAGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013807.1-662s1c1
Sequence:CCGGCACGGATAACATGGAACTGAACTCGAGTTCAGTTCCATGTTATCCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013807.1-1118s1c1
Sequence:CCGGCAAAGTTACCAAGAGCCTGTTCTCGAGAACAGGCTCTTGGTAACTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013807.2-397s21c1
Sequence:CCGGTCAGCGCGAGAAGATCCTAAACTCGAGTTTAGGATCTTCTCGCGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013807.2-477s21c1
Sequence:CCGGTCGAGGATGCTGACAACATATCTCGAGATATGTTGTCAGCATCCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013807.2-345s21c1
Sequence:CCGGGTATAGCCTACGCGGTCAAAGCTCGAGCTTTGACCGCGTAGGCTATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004073
VALIDATED
PLK3 MISSION shRNA Bacterial Glycerol Stock
polo-like kinase 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004073.x-2072s1c1
Sequence:CCGGGGCGTTATTTATGGACCACTTCTCGAGAAGTGGTCCATAAATAACGCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.x-1570s1c1
Sequence:CCGGAGTGTGGAAGAGGTAGAGGTACTCGAGTACCTCTACCTCTTCCACACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.x-987s1c1
Sequence:CCGGGAAGAGTAAGAATCATGCCCACTCGAGTGGGCATGATTCTTACTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004073.x-310s1c1
Sequence:CCGGGACGCTGACAACATCTACATTCTCGAGAATGTAGATGTTGTCAGCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_004073.2-2085s1c1
Sequence:CCGGGCCCTTGCCTTTGTGGCCTTCCTCGAGGAAGGCCACAAAGGCAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.2-1519s1c1
Sequence:CCGGGTTCGGCTTTGGGTATCAACTCTCGAGAGTTGATACCCAAAGCCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004073.2-2211s1c1
Sequence:CCGGCCATCTCCAAGATAAGCCTGACTCGAGTCAGGCTTATCTTGGAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.2-1564s1c1
Sequence:CCGGCTTCAACGATGGCACACATATCTCGAGATATGTGTGCCATCGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.2-1359s1c1
Sequence:CCGGGATTTGAAGAAGGTCTGACTGCTCGAGCAGTCAGACCTTCTTCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004073.2-492s21c1
Sequence:CCGGACGCTGACAACATCTACATTTCTCGAGAAATGTAGATGTTGTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004073.2-1498s21c1
Sequence:CCGGGTGGGTTGACTACTCCAATAACTCGAGTTATTGGAGTAGTCAACCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004073.2-652s21c1
Sequence:CCGGGGACCTCAAGTTGGGAAATTTCTCGAGAAATTTCCCAACTTGAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004073.2-406s21c1
Sequence:CCGGTCAGCGCGAGAAGATCCTAAACTCGAGTTTAGGATCTTCTCGCGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004073.2-2152s21c1
Sequence:CCGGGGGAATCAGGGACCAGCTTTACTCGAGTAAAGCTGGTCCCTGATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004073
VALIDATED
PLK3 MISSION shRNA shRNA Plasmid DNA
polo-like kinase 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004073.x-2072s1c1
Sequence:CCGGGGCGTTATTTATGGACCACTTCTCGAGAAGTGGTCCATAAATAACGCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.x-1570s1c1
Sequence:CCGGAGTGTGGAAGAGGTAGAGGTACTCGAGTACCTCTACCTCTTCCACACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.x-987s1c1
Sequence:CCGGGAAGAGTAAGAATCATGCCCACTCGAGTGGGCATGATTCTTACTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004073.x-310s1c1
Sequence:CCGGGACGCTGACAACATCTACATTCTCGAGAATGTAGATGTTGTCAGCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_004073.2-2085s1c1
Sequence:CCGGGCCCTTGCCTTTGTGGCCTTCCTCGAGGAAGGCCACAAAGGCAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.2-1519s1c1
Sequence:CCGGGTTCGGCTTTGGGTATCAACTCTCGAGAGTTGATACCCAAAGCCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004073.2-2211s1c1
Sequence:CCGGCCATCTCCAAGATAAGCCTGACTCGAGTCAGGCTTATCTTGGAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.2-1564s1c1
Sequence:CCGGCTTCAACGATGGCACACATATCTCGAGATATGTGTGCCATCGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.2-1359s1c1
Sequence:CCGGGATTTGAAGAAGGTCTGACTGCTCGAGCAGTCAGACCTTCTTCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004073.2-492s21c1
Sequence:CCGGACGCTGACAACATCTACATTTCTCGAGAAATGTAGATGTTGTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004073.2-1498s21c1
Sequence:CCGGGTGGGTTGACTACTCCAATAACTCGAGTTATTGGAGTAGTCAACCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004073.2-652s21c1
Sequence:CCGGGGACCTCAAGTTGGGAAATTTCTCGAGAAATTTCCCAACTTGAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004073.2-406s21c1
Sequence:CCGGTCAGCGCGAGAAGATCCTAAACTCGAGTTTAGGATCTTCTCGCGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004073.2-2152s21c1
Sequence:CCGGGGGAATCAGGGACCAGCTTTACTCGAGTAAAGCTGGTCCCTGATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004073
VALIDATED
PLK3 MISSION shRNA Lentiviral Transduction Particles
polo-like kinase 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004073.x-2072s1c1
Sequence:CCGGGGCGTTATTTATGGACCACTTCTCGAGAAGTGGTCCATAAATAACGCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.x-1570s1c1
Sequence:CCGGAGTGTGGAAGAGGTAGAGGTACTCGAGTACCTCTACCTCTTCCACACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.x-987s1c1
Sequence:CCGGGAAGAGTAAGAATCATGCCCACTCGAGTGGGCATGATTCTTACTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004073.x-310s1c1
Sequence:CCGGGACGCTGACAACATCTACATTCTCGAGAATGTAGATGTTGTCAGCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_004073.2-2085s1c1
Sequence:CCGGGCCCTTGCCTTTGTGGCCTTCCTCGAGGAAGGCCACAAAGGCAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.2-1519s1c1
Sequence:CCGGGTTCGGCTTTGGGTATCAACTCTCGAGAGTTGATACCCAAAGCCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004073.2-2211s1c1
Sequence:CCGGCCATCTCCAAGATAAGCCTGACTCGAGTCAGGCTTATCTTGGAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.2-1564s1c1
Sequence:CCGGCTTCAACGATGGCACACATATCTCGAGATATGTGTGCCATCGTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004073.2-1359s1c1
Sequence:CCGGGATTTGAAGAAGGTCTGACTGCTCGAGCAGTCAGACCTTCTTCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004073.2-492s21c1
Sequence:CCGGACGCTGACAACATCTACATTTCTCGAGAAATGTAGATGTTGTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004073.2-1498s21c1
Sequence:CCGGGTGGGTTGACTACTCCAATAACTCGAGTTATTGGAGTAGTCAACCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004073.2-652s21c1
Sequence:CCGGGGACCTCAAGTTGGGAAATTTCTCGAGAAATTTCCCAACTTGAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004073.2-406s21c1
Sequence:CCGGTCAGCGCGAGAAGATCCTAAACTCGAGTTTAGGATCTTCTCGCGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004073.2-2152s21c1
Sequence:CCGGGGGAATCAGGGACCAGCTTTACTCGAGTAAAGCTGGTCCCTGATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)