EMAIL THIS PAGE TO A FRIEND

PLK4

polo-like kinase 4

93 Gene Product Result for
Synonyms: SAK STK18
Gene ID:
Human(10733) Summary: This gene encodes a member of the polo family of serine/threonine protein kinases. The protein localizes to centrioles, complex microtubule-based structures found in centrosomes, and regulates centriole duplication during the cell cycle. Three alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(20873) polo-like kinase 4
Rat(310344) polo-like kinase 4
cow(514405) polo-like kinase 4
sheep(101121970) polo-like kinase 4
naked mole-rat(101723384) polo-like kinase 4
domestic guinea pig(100723956) polo-like kinase 4
Zebrafish(368390) polo-like kinase 4 (Drosophila)
domestic cat(101086791) polo-like kinase 4
Horse(100063593) polo-like kinase 4
dog(476087) polo-like kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014264 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014264 siRNAs that have been validated in the lab human pricing
NM_001107669 Rosetta Predictions rat pricing
NM_011495 Rosetta Predictions mouse pricing
NM_173169 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014264 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000046 validated 2566
1 SASI_Hs01_00086201 validated 279
1 SASI_WI_00000048 validated 3170
2 SASI_Hs01_00086200 predicted 766
3 SASI_Hs01_00086202 predicted 2554
4 SASI_Hs02_00345326 predicted 2137
5 SASI_Hs01_00086203 predicted 1896
6 SASI_Hs02_00345327 predicted 585
7 SASI_Hs01_00086205 predicted 2004
8 SASI_Hs01_00086206 predicted 1341
9 SASI_Hs02_00345328 predicted 367
10 SASI_Hs01_00086207 predicted 984
11 SASI_Hs01_00086204 predicted 384
12 SASI_Hs01_00086208 predicted 1062
13 SASI_Hs01_00086209 predicted 2494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231105 predicted 2363
2 SASI_Rn02_00231106 predicted 1371
3 SASI_Rn02_00231107 predicted 384
4 SASI_Rn02_00231108 predicted 1935
5 SASI_Rn02_00231109 predicted 1387
6 SASI_Rn02_00231110 predicted 1559
7 SASI_Rn02_00231111 predicted 715
8 SASI_Rn02_00231112 predicted 1917
9 SASI_Rn02_00231113 predicted 1623
10 SASI_Rn02_00231114 predicted 2530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320792 predicted 2179
2 SASI_Mm02_00320793 predicted 437
3 SASI_Mm02_00320794 predicted 2236
4 SASI_Mm02_00320795 predicted 2114
5 SASI_Mm02_00320796 predicted 1930
6 SASI_Mm01_00090643 predicted 652
7 SASI_Mm02_00320797 predicted 2253
8 SASI_Mm02_00320798 predicted 769
9 SASI_Mm02_00320799 predicted 423
10 SASI_Mm02_00320800 predicted 1715
11 SASI_Mm01_00090639 predicted 515
12 SASI_Mm01_00090640 predicted 429
13 SASI_Mm01_00090641 predicted 541
14 SASI_Mm01_00090642 predicted 490
15 SASI_Mm01_00090644 predicted 469
16 SASI_Mm01_00090645 predicted 527
17 SASI_Mm01_00090646 predicted 542
18 SASI_Mm01_00090647 predicted 518
19 SASI_Mm01_00090648 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134541 predicted 542
2 SASI_Mm01_00134542 predicted 454
3 SASI_Mm01_00134543 predicted 566
4 SASI_Mm01_00134544 predicted 512
5 SASI_Mm01_00134545 predicted 561
6 SASI_Mm01_00134546 predicted 495
7 SASI_Mm01_00134547 predicted 574
8 SASI_Mm01_00134548 predicted 551
9 SASI_Mm01_00134549 predicted 519
10 SASI_Mm01_00134550 predicted 438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014264
VALIDATED
PLK4 MISSION shRNA Bacterial Glycerol Stock
polo-like kinase 4
Human
30 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-2024s21c1
Sequence:GTACCGGGTTGGTTGCTCACAGGTTAAACTCGAGTTTAACCTGTGAGCAACCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-963s21c1
Sequence:CCGGGACCTTATTCACCAGTTACTTCTCGAGAAGTAACTGGTGAATAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-915s1c1
Sequence:CCGGCACCAGTTACTTCGTAGAAATCTCGAGATTTCTACGAAGTAACTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-2904s1c1
Sequence:CCGGGCTGTGTGGGTTCAGTTTAATCTCGAGATTAAACTGAACCCACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-1300s1c1
Sequence:CCGGGATACCTTCGTAGAGCTTATTCTCGAGAATAAGCTCTACGAAGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-2953s1c1
Sequence:CCGGGAGTGTCTTCTATCAGTTATACTCGAGTATAACTGATAGAAGACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-1986s21c1
Sequence:CCGGGGTTATCAGAATCGTACATTACTCGAGTAATGTACGATTCTGATAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-669s21c1
Sequence:CCGGCTCCTACTGACTCGTAATATGCTCGAGCATATTACGAGTCAGTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-988s21c1
Sequence:CCGGGAAATCCAGCAGATCGTTTAACTCGAGTTAAACGATCTGCTGGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-2560s21c1
Sequence:GTACCGGCTAATGAGGGTCATCGTATTTCTCGAGAAATACGATGACCCTCATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-1599s1c1
Sequence:CCGGCCTCAGACTGAAACCGTACAACTCGAGTTGTACGGTTTCAGTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014264.3-3393s21c1
Sequence:CCGGCCGAACTTACTATGTTCATATCTCGAGATATGAACATAGTAAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-3021s1c1
Sequence:CCGGCCAGACTACATCAAACAGAAACTCGAGTTTCTGTTTGATGTAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-906s1c1
Sequence:CCGGGACCTTATTCACCAGTTACTTCTCGAGAAGTAACTGGTGAATAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2425s1c1
Sequence:CCGGCAGGGAAGTCTTACACTTTAACTCGAGTTAAAGTGTAAGACTTCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2070s1c1
Sequence:CCGGGCATCTCAAGAATATGTGAAACTCGAGTTTCACATATTCTTGAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-1308s1c1
Sequence:CCGGCGTAGAGCTTATTCCTCTGATCTCGAGATCAGAGGAATAAGCTCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-1087s1c1
Sequence:CCGGCCAGTATAAGTGGTAGTTTATCTCGAGATAAACTACCACTTATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-1050s1c1
Sequence:CCGGGCCACAATTTCTACTGCAATTCTCGAGAATTGCAGTAGAAATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2974s1c1
Sequence:CCGGCCTCACCAAATGGTCAAACAACTCGAGTTGTTTGACCATTTGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-3108s1c1
Sequence:CCGGCTCCTTTCAGACATATAAGTTCTCGAGAACTTATATGTCTGAAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-712s1c1
Sequence:CCGGCTAACTACATTTCACCAGAAACTCGAGTTTCTGGTGAAATGTAGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014264.x-3303s1c1
Sequence:CCGGGAACACCTGACTTTGCTCTTACTCGAGTAAGAGCAAAGTCAGGTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-493s21c1
Sequence:GTACCGGATTATGTGTATCTGGTATTAGCTCGAGCTAATACCAGATACACATAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.x-433s1c1
Sequence:CCGGGCAATTATGTGTATCTGGTATCTCGAGATACCAGATACACATAATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.x-2745s1c1
Sequence:CCGGCCCTCTATGGTTACAAATGAACTCGAGTTCATTTGTAACCATAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.x-1966s1c1
Sequence:CCGGCGTTGGTTGCTCACAGGTTAACTCGAGTTAACCTGTGAGCAACCAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2962s1c1
Sequence:CCGGCTATCAGTTATACCTCACCAACTCGAGTTGGTGAGGTATAACTGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-2585s1c1
Sequence:CCGGCCCAATAATCATAGGAAGAAACTCGAGTTTCTTCCTATGATTATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2112s1c1
Sequence:CCGGGATGGAAATACGATCACTATTCTCGAGAATAGTGATCGTATTTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014264
VALIDATED
PLK4 MISSION shRNA shRNA Plasmid DNA
polo-like kinase 4
Human
30 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-2024s21c1
Sequence:GTACCGGGTTGGTTGCTCACAGGTTAAACTCGAGTTTAACCTGTGAGCAACCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-963s21c1
Sequence:CCGGGACCTTATTCACCAGTTACTTCTCGAGAAGTAACTGGTGAATAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-915s1c1
Sequence:CCGGCACCAGTTACTTCGTAGAAATCTCGAGATTTCTACGAAGTAACTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-2904s1c1
Sequence:CCGGGCTGTGTGGGTTCAGTTTAATCTCGAGATTAAACTGAACCCACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-1300s1c1
Sequence:CCGGGATACCTTCGTAGAGCTTATTCTCGAGAATAAGCTCTACGAAGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-2953s1c1
Sequence:CCGGGAGTGTCTTCTATCAGTTATACTCGAGTATAACTGATAGAAGACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-1986s21c1
Sequence:CCGGGGTTATCAGAATCGTACATTACTCGAGTAATGTACGATTCTGATAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-669s21c1
Sequence:CCGGCTCCTACTGACTCGTAATATGCTCGAGCATATTACGAGTCAGTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-988s21c1
Sequence:CCGGGAAATCCAGCAGATCGTTTAACTCGAGTTAAACGATCTGCTGGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-2560s21c1
Sequence:GTACCGGCTAATGAGGGTCATCGTATTTCTCGAGAAATACGATGACCCTCATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-1599s1c1
Sequence:CCGGCCTCAGACTGAAACCGTACAACTCGAGTTGTACGGTTTCAGTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014264.3-3393s21c1
Sequence:CCGGCCGAACTTACTATGTTCATATCTCGAGATATGAACATAGTAAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-3021s1c1
Sequence:CCGGCCAGACTACATCAAACAGAAACTCGAGTTTCTGTTTGATGTAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-906s1c1
Sequence:CCGGGACCTTATTCACCAGTTACTTCTCGAGAAGTAACTGGTGAATAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2425s1c1
Sequence:CCGGCAGGGAAGTCTTACACTTTAACTCGAGTTAAAGTGTAAGACTTCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2070s1c1
Sequence:CCGGGCATCTCAAGAATATGTGAAACTCGAGTTTCACATATTCTTGAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-1308s1c1
Sequence:CCGGCGTAGAGCTTATTCCTCTGATCTCGAGATCAGAGGAATAAGCTCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-1087s1c1
Sequence:CCGGCCAGTATAAGTGGTAGTTTATCTCGAGATAAACTACCACTTATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-1050s1c1
Sequence:CCGGGCCACAATTTCTACTGCAATTCTCGAGAATTGCAGTAGAAATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2974s1c1
Sequence:CCGGCCTCACCAAATGGTCAAACAACTCGAGTTGTTTGACCATTTGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-3108s1c1
Sequence:CCGGCTCCTTTCAGACATATAAGTTCTCGAGAACTTATATGTCTGAAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-712s1c1
Sequence:CCGGCTAACTACATTTCACCAGAAACTCGAGTTTCTGGTGAAATGTAGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014264.x-3303s1c1
Sequence:CCGGGAACACCTGACTTTGCTCTTACTCGAGTAAGAGCAAAGTCAGGTGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-493s21c1
Sequence:GTACCGGATTATGTGTATCTGGTATTAGCTCGAGCTAATACCAGATACACATAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.x-433s1c1
Sequence:CCGGGCAATTATGTGTATCTGGTATCTCGAGATACCAGATACACATAATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.x-2745s1c1
Sequence:CCGGCCCTCTATGGTTACAAATGAACTCGAGTTCATTTGTAACCATAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.x-1966s1c1
Sequence:CCGGCGTTGGTTGCTCACAGGTTAACTCGAGTTAACCTGTGAGCAACCAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2962s1c1
Sequence:CCGGCTATCAGTTATACCTCACCAACTCGAGTTGGTGAGGTATAACTGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-2585s1c1
Sequence:CCGGCCCAATAATCATAGGAAGAAACTCGAGTTTCTTCCTATGATTATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2112s1c1
Sequence:CCGGGATGGAAATACGATCACTATTCTCGAGAATAGTGATCGTATTTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014264
VALIDATED
PLK4 MISSION shRNA Lentiviral Transduction Particles
polo-like kinase 4
Human
30 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-2024s21c1
Sequence:GTACCGGGTTGGTTGCTCACAGGTTAAACTCGAGTTTAACCTGTGAGCAACCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-963s21c1
Sequence:CCGGGACCTTATTCACCAGTTACTTCTCGAGAAGTAACTGGTGAATAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-915s1c1
Sequence:CCGGCACCAGTTACTTCGTAGAAATCTCGAGATTTCTACGAAGTAACTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-2904s1c1
Sequence:CCGGGCTGTGTGGGTTCAGTTTAATCTCGAGATTAAACTGAACCCACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-1300s1c1
Sequence:CCGGGATACCTTCGTAGAGCTTATTCTCGAGAATAAGCTCTACGAAGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-2953s1c1
Sequence:CCGGGAGTGTCTTCTATCAGTTATACTCGAGTATAACTGATAGAAGACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-1986s21c1
Sequence:CCGGGGTTATCAGAATCGTACATTACTCGAGTAATGTACGATTCTGATAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-669s21c1
Sequence:CCGGCTCCTACTGACTCGTAATATGCTCGAGCATATTACGAGTCAGTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-988s21c1
Sequence:CCGGGAAATCCAGCAGATCGTTTAACTCGAGTTAAACGATCTGCTGGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-2560s21c1
Sequence:GTACCGGCTAATGAGGGTCATCGTATTTCTCGAGAAATACGATGACCCTCATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-1599s1c1
Sequence:CCGGCCTCAGACTGAAACCGTACAACTCGAGTTGTACGGTTTCAGTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014264.3-3393s21c1
Sequence:CCGGCCGAACTTACTATGTTCATATCTCGAGATATGAACATAGTAAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-3021s1c1
Sequence:CCGGCCAGACTACATCAAACAGAAACTCGAGTTTCTGTTTGATGTAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-906s1c1
Sequence:CCGGGACCTTATTCACCAGTTACTTCTCGAGAAGTAACTGGTGAATAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2425s1c1
Sequence:CCGGCAGGGAAGTCTTACACTTTAACTCGAGTTAAAGTGTAAGACTTCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2070s1c1
Sequence:CCGGGCATCTCAAGAATATGTGAAACTCGAGTTTCACATATTCTTGAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-1308s1c1
Sequence:CCGGCGTAGAGCTTATTCCTCTGATCTCGAGATCAGAGGAATAAGCTCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-1087s1c1
Sequence:CCGGCCAGTATAAGTGGTAGTTTATCTCGAGATAAACTACCACTTATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-1050s1c1
Sequence:CCGGGCCACAATTTCTACTGCAATTCTCGAGAATTGCAGTAGAAATTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2974s1c1
Sequence:CCGGCCTCACCAAATGGTCAAACAACTCGAGTTGTTTGACCATTTGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-3108s1c1
Sequence:CCGGCTCCTTTCAGACATATAAGTTCTCGAGAACTTATATGTCTGAAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-712s1c1
Sequence:CCGGCTAACTACATTTCACCAGAAACTCGAGTTTCTGGTGAAATGTAGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014264.x-3303s1c1
Sequence:CCGGGAACACCTGACTTTGCTCTTACTCGAGTAAGAGCAAAGTCAGGTGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014264.3-493s21c1
Sequence:GTACCGGATTATGTGTATCTGGTATTAGCTCGAGCTAATACCAGATACACATAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.x-433s1c1
Sequence:CCGGGCAATTATGTGTATCTGGTATCTCGAGATACCAGATACACATAATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.x-2745s1c1
Sequence:CCGGCCCTCTATGGTTACAAATGAACTCGAGTTCATTTGTAACCATAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.x-1966s1c1
Sequence:CCGGCGTTGGTTGCTCACAGGTTAACTCGAGTTAACCTGTGAGCAACCAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2962s1c1
Sequence:CCGGCTATCAGTTATACCTCACCAACTCGAGTTGGTGAGGTATAACTGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014264.2-2585s1c1
Sequence:CCGGCCCAATAATCATAGGAAGAAACTCGAGTTTCTTCCTATGATTATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014264.2-2112s1c1
Sequence:CCGGGATGGAAATACGATCACTATTCTCGAGAATAGTGATCGTATTTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011495
VALIDATED
PLK4 MISSION shRNA Bacterial Glycerol Stock
polo-like kinase 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-352s21c1
Sequence:CCGGCTACTCGGTAAAGGATCATTTCTCGAGAAATGATCCTTTACCGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-2207s21c1
Sequence:CCGGGCTTTGACAATCTACCAGAAACTCGAGTTTCTGGTAGATTGTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-3084s21c1
Sequence:CCGGTAAGTCTCAGAAGTCTATATTCTCGAGAATATAGACTTCTGAGACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-1029s21c1
Sequence:CCGGCCACCAGTTACTTCGTAGAAACTCGAGTTTCTACGAAGTAACTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-1594s1c1
Sequence:CCGGCCAGATTTGCAGGACACGTTACTCGAGTAACGTGTCCTGCAAATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-2132s1c1
Sequence:CCGGCCAGATTCATTCAGCTAGTAACTCGAGTTACTAGCTGAATGAATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-207s1c1
Sequence:CCGGCGAGGACTTTAAGGTTGGAAACTCGAGTTTCCAACCTTAAAGTCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-2084s1c1
Sequence:CCGGGCTTTGACAATCTACCAGAAACTCGAGTTTCTGGTAGATTGTCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-906s1c1
Sequence:CCGGCCACCAGTTACTTCGTAGAAACTCGAGTTTCTACGAAGTAACTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-2255s21c1
Sequence:CCGGCCAGATTCATTCAGCTAGTAACTCGAGTTACTAGCTGAATGAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011495
VALIDATED
PLK4 MISSION shRNA shRNA Plasmid DNA
polo-like kinase 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-352s21c1
Sequence:CCGGCTACTCGGTAAAGGATCATTTCTCGAGAAATGATCCTTTACCGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-2207s21c1
Sequence:CCGGGCTTTGACAATCTACCAGAAACTCGAGTTTCTGGTAGATTGTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-3084s21c1
Sequence:CCGGTAAGTCTCAGAAGTCTATATTCTCGAGAATATAGACTTCTGAGACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-1029s21c1
Sequence:CCGGCCACCAGTTACTTCGTAGAAACTCGAGTTTCTACGAAGTAACTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-1594s1c1
Sequence:CCGGCCAGATTTGCAGGACACGTTACTCGAGTAACGTGTCCTGCAAATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-2132s1c1
Sequence:CCGGCCAGATTCATTCAGCTAGTAACTCGAGTTACTAGCTGAATGAATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-207s1c1
Sequence:CCGGCGAGGACTTTAAGGTTGGAAACTCGAGTTTCCAACCTTAAAGTCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-2084s1c1
Sequence:CCGGGCTTTGACAATCTACCAGAAACTCGAGTTTCTGGTAGATTGTCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-906s1c1
Sequence:CCGGCCACCAGTTACTTCGTAGAAACTCGAGTTTCTACGAAGTAACTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-2255s21c1
Sequence:CCGGCCAGATTCATTCAGCTAGTAACTCGAGTTACTAGCTGAATGAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011495
VALIDATED
PLK4 MISSION shRNA Lentiviral Transduction Particles
polo-like kinase 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-352s21c1
Sequence:CCGGCTACTCGGTAAAGGATCATTTCTCGAGAAATGATCCTTTACCGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-2207s21c1
Sequence:CCGGGCTTTGACAATCTACCAGAAACTCGAGTTTCTGGTAGATTGTCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-3084s21c1
Sequence:CCGGTAAGTCTCAGAAGTCTATATTCTCGAGAATATAGACTTCTGAGACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-1029s21c1
Sequence:CCGGCCACCAGTTACTTCGTAGAAACTCGAGTTTCTACGAAGTAACTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-1594s1c1
Sequence:CCGGCCAGATTTGCAGGACACGTTACTCGAGTAACGTGTCCTGCAAATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-2132s1c1
Sequence:CCGGCCAGATTCATTCAGCTAGTAACTCGAGTTACTAGCTGAATGAATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-207s1c1
Sequence:CCGGCGAGGACTTTAAGGTTGGAAACTCGAGTTTCCAACCTTAAAGTCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-2084s1c1
Sequence:CCGGGCTTTGACAATCTACCAGAAACTCGAGTTTCTGGTAGATTGTCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011495.1-906s1c1
Sequence:CCGGCCACCAGTTACTTCGTAGAAACTCGAGTTTCTACGAAGTAACTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011495.2-2255s21c1
Sequence:CCGGCCAGATTCATTCAGCTAGTAACTCGAGTTACTAGCTGAATGAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)