EMAIL THIS PAGE TO A FRIEND

PLLP

plasmolipin

47 Gene Product Result for
Synonyms: PMLP TM4SF11
UniProtKB ID: Q9Y342, B2R9T6
Gene ID:
Mouse(67801) plasma membrane proteolipid
Rat(64364) plasmolipin
chicken(415650) plasmolipin
dog(100685289) plasmolipin
cow(613446) plasmolipin
sheep(101122880) plasmolipin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015993 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109251 MISSION® esiRNA esiRNA human PLLP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015993 Rosetta Predictions human pricing
NM_022533 Rosetta Predictions rat pricing
NM_026385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089179 predicted 1086
2 SASI_Hs01_00089180 predicted 423
3 SASI_Hs02_00348672 predicted 798
4 SASI_Hs01_00089181 predicted 492
5 SASI_Hs01_00089182 predicted 360
6 SASI_Hs01_00089183 predicted 432
7 SASI_Hs02_00348673 predicted 323
8 SASI_Hs01_00089184 predicted 583
9 SASI_Hs01_00089186 predicted 1055
10 SASI_Hs01_00089187 predicted 1047
11 SASI_Hs01_00089185 predicted 1125
12 SASI_Hs01_00089188 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043217 predicted 1047
2 SASI_Rn01_00043218 predicted 507
3 SASI_Rn01_00043220 predicted 1010
4 SASI_Rn01_00043221 predicted 1216
5 SASI_Rn01_00043222 predicted 1004
6 SASI_Rn01_00043223 predicted 1004
7 SASI_Rn02_00263285 predicted 1222
8 SASI_Rn01_00043224 predicted 1209
9 SASI_Rn01_00043226 predicted 1158
10 SASI_Rn02_00263286 predicted 1165
11 SASI_Rn01_00043219 predicted 1220
12 SASI_Rn01_00043225 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120490 predicted 859
2 SASI_Mm01_00120491 predicted 370
3 SASI_Mm01_00120493 predicted 533
4 SASI_Mm01_00120494 predicted 264
5 SASI_Mm01_00120495 predicted 331
6 SASI_Mm01_00120496 predicted 248
7 SASI_Mm01_00120497 predicted 868
8 SASI_Mm01_00120498 predicted 274
9 SASI_Mm01_00120499 predicted 286
10 SASI_Mm02_00330138 predicted 676
11 SASI_Mm01_00120492 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015993
PLLP MISSION shRNA Bacterial Glycerol Stock
plasmolipin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015993.2-1000s21c1
Sequence:CCGGCCTTCTCACCAGCACTAAATGCTCGAGCATTTAGTGCTGGTGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015993.1-429s1c1
Sequence:CCGGCCACTGGTGTTAATGATCTTTCTCGAGAAAGATCATTAACACCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015993.1-374s1c1
Sequence:CCGGCCTCTTCAACCTCTACCTGTTCTCGAGAACAGGTAGAGGTTGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015993.1-1312s1c1
Sequence:CCGGCCCAAGCCTCTCTCTGTAATACTCGAGTATTACAGAGAGAGGCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015993.1-430s1c1
Sequence:CCGGCACTGGTGTTAATGATCTTTACTCGAGTAAAGATCATTAACACCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015993.2-401s21c1
Sequence:CCGGAGCTGCACATGAAGTTGTACACTCGAGTGTACAACTTCATGTGCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015993.2-559s21c1
Sequence:CCGGGCCTCGTTCTTTGCGTGTTTGCTCGAGCAAACACGCAAAGAACGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015993
PLLP MISSION shRNA shRNA Plasmid DNA
plasmolipin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015993.2-1000s21c1
Sequence:CCGGCCTTCTCACCAGCACTAAATGCTCGAGCATTTAGTGCTGGTGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015993.1-429s1c1
Sequence:CCGGCCACTGGTGTTAATGATCTTTCTCGAGAAAGATCATTAACACCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015993.1-374s1c1
Sequence:CCGGCCTCTTCAACCTCTACCTGTTCTCGAGAACAGGTAGAGGTTGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015993.1-1312s1c1
Sequence:CCGGCCCAAGCCTCTCTCTGTAATACTCGAGTATTACAGAGAGAGGCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015993.1-430s1c1
Sequence:CCGGCACTGGTGTTAATGATCTTTACTCGAGTAAAGATCATTAACACCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015993.2-401s21c1
Sequence:CCGGAGCTGCACATGAAGTTGTACACTCGAGTGTACAACTTCATGTGCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015993.2-559s21c1
Sequence:CCGGGCCTCGTTCTTTGCGTGTTTGCTCGAGCAAACACGCAAAGAACGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015993
PLLP MISSION shRNA Lentiviral Transduction Particles
plasmolipin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015993.2-1000s21c1
Sequence:CCGGCCTTCTCACCAGCACTAAATGCTCGAGCATTTAGTGCTGGTGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015993.1-429s1c1
Sequence:CCGGCCACTGGTGTTAATGATCTTTCTCGAGAAAGATCATTAACACCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015993.1-374s1c1
Sequence:CCGGCCTCTTCAACCTCTACCTGTTCTCGAGAACAGGTAGAGGTTGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015993.1-1312s1c1
Sequence:CCGGCCCAAGCCTCTCTCTGTAATACTCGAGTATTACAGAGAGAGGCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015993.1-430s1c1
Sequence:CCGGCACTGGTGTTAATGATCTTTACTCGAGTAAAGATCATTAACACCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015993.2-401s21c1
Sequence:CCGGAGCTGCACATGAAGTTGTACACTCGAGTGTACAACTTCATGTGCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015993.2-559s21c1
Sequence:CCGGGCCTCGTTCTTTGCGTGTTTGCTCGAGCAAACACGCAAAGAACGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026385
VALIDATED
PLLP MISSION shRNA Bacterial Glycerol Stock
plasmolipin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026385.4-266s21c1
Sequence:CCGGCCTATGGCTGGGTCATGTTTGCTCGAGCAAACATGACCCAGCCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026385.4-509s21c1
Sequence:CCGGTTGCTTGTCTGGTGATGATTGCTCGAGCAATCATCACCAGACAAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026385.4-531s21c1
Sequence:CCGGCTACGGAGTGAGCGCTTTCTTCTCGAGAAGAAAGCGCTCACTCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026385.4-908s21c1
Sequence:CCGGCCTCAGTATAACCCTAACAAACTCGAGTTTGTTAGGGTTATACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026385.3-304s1c1
Sequence:CCGGGCTGGTGACAATCGTCTTCTTCTCGAGAAGAAGACGATTGTCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026385.3-374s1c1
Sequence:CCGGCCGTTGGTGTTACTGATCTTTCTCGAGAAAGATCAGTAACACCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026385.3-334s1c1
Sequence:CCGGCCTGTTTCAACTGCACATGAACTCGAGTTCATGTGCAGTTGAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026385.3-412s1c1
Sequence:CCGGTCTCTACATTACTGCCTTTATCTCGAGATAAAGGCAGTAATGTAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026385.3-909s1c1
Sequence:CCGGCCTCAGTATAACCCTAACAAACTCGAGTTTGTTAGGGTTATACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026385.4-411s21c1
Sequence:CCGGTCTCTACATTACTGCCTTTATCTCGAGATAAAGGCAGTAATGTAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026385
VALIDATED
PLLP MISSION shRNA shRNA Plasmid DNA
plasmolipin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026385.4-266s21c1
Sequence:CCGGCCTATGGCTGGGTCATGTTTGCTCGAGCAAACATGACCCAGCCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026385.4-509s21c1
Sequence:CCGGTTGCTTGTCTGGTGATGATTGCTCGAGCAATCATCACCAGACAAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026385.4-531s21c1
Sequence:CCGGCTACGGAGTGAGCGCTTTCTTCTCGAGAAGAAAGCGCTCACTCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026385.4-908s21c1
Sequence:CCGGCCTCAGTATAACCCTAACAAACTCGAGTTTGTTAGGGTTATACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026385.3-304s1c1
Sequence:CCGGGCTGGTGACAATCGTCTTCTTCTCGAGAAGAAGACGATTGTCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026385.3-374s1c1
Sequence:CCGGCCGTTGGTGTTACTGATCTTTCTCGAGAAAGATCAGTAACACCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026385.3-334s1c1
Sequence:CCGGCCTGTTTCAACTGCACATGAACTCGAGTTCATGTGCAGTTGAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026385.3-412s1c1
Sequence:CCGGTCTCTACATTACTGCCTTTATCTCGAGATAAAGGCAGTAATGTAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026385.3-909s1c1
Sequence:CCGGCCTCAGTATAACCCTAACAAACTCGAGTTTGTTAGGGTTATACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026385.4-411s21c1
Sequence:CCGGTCTCTACATTACTGCCTTTATCTCGAGATAAAGGCAGTAATGTAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026385
VALIDATED
PLLP MISSION shRNA Lentiviral Transduction Particles
plasmolipin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026385.4-266s21c1
Sequence:CCGGCCTATGGCTGGGTCATGTTTGCTCGAGCAAACATGACCCAGCCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026385.4-509s21c1
Sequence:CCGGTTGCTTGTCTGGTGATGATTGCTCGAGCAATCATCACCAGACAAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026385.4-531s21c1
Sequence:CCGGCTACGGAGTGAGCGCTTTCTTCTCGAGAAGAAAGCGCTCACTCCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026385.4-908s21c1
Sequence:CCGGCCTCAGTATAACCCTAACAAACTCGAGTTTGTTAGGGTTATACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026385.3-304s1c1
Sequence:CCGGGCTGGTGACAATCGTCTTCTTCTCGAGAAGAAGACGATTGTCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026385.3-374s1c1
Sequence:CCGGCCGTTGGTGTTACTGATCTTTCTCGAGAAAGATCAGTAACACCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026385.3-334s1c1
Sequence:CCGGCCTGTTTCAACTGCACATGAACTCGAGTTCATGTGCAGTTGAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026385.3-412s1c1
Sequence:CCGGTCTCTACATTACTGCCTTTATCTCGAGATAAAGGCAGTAATGTAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026385.3-909s1c1
Sequence:CCGGCCTCAGTATAACCCTAACAAACTCGAGTTTGTTAGGGTTATACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026385.4-411s21c1
Sequence:CCGGTCTCTACATTACTGCCTTTATCTCGAGATAAAGGCAGTAATGTAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)