EMAIL THIS PAGE TO A FRIEND

PLOD1

procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1

54 Gene Product Result for
Synonyms: EDS6 LH LH1 LLH PLOD
UniProtKB ID: Q02809, Q96AV9, Q9H132
Gene ID:
Human(5351) Summary: Lysyl hydroxylase is a membrane-bound homodimeric protein localized to the cisternae of the endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VI have deficiencies in lysyl hydroxylase activity. [provided by RefSeq, Jul 2008]
Mouse(18822) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Rat(116552) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
chicken(419485) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
dog(487440) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
domestic cat(101100822) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
cow(281409) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Goat(100861039) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
sheep(101111306) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
naked mole-rat(101716463) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
domestic guinea pig(100714306) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011122 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011122 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011122 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000302 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009851 MISSION® esiRNA esiRNA targeting human PLOD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000302 Rosetta Predictions human pricing
NM_053827 Rosetta Predictions rat pricing
NM_011122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062396 predicted 1875
2 SASI_Hs01_00062397 predicted 2297
3 SASI_Hs02_00302287 predicted 2070
4 SASI_Hs02_00302288 predicted 1809
5 SASI_Hs01_00062399 predicted 1902
6 SASI_Hs01_00062401 predicted 849
7 SASI_Hs01_00062402 predicted 1973
8 SASI_Hs01_00062403 predicted 1173
9 SASI_Hs01_00062404 predicted 390
10 SASI_Hs01_00062405 predicted 2027
11 SASI_Hs01_00062398 predicted 369
12 SASI_Hs01_00062400 predicted 2009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116007 predicted 1267
2 SASI_Rn01_00116008 predicted 1349
3 SASI_Rn01_00116009 predicted 2359
4 SASI_Rn01_00116010 predicted 1938
5 SASI_Rn01_00116012 predicted 1162
6 SASI_Rn01_00116013 predicted 1574
7 SASI_Rn01_00116014 predicted 912
8 SASI_Rn01_00116015 predicted 1734
9 SASI_Rn01_00116016 predicted 2294
10 SASI_Rn02_00266663 predicted 903
11 SASI_Rn01_00116011 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128288 predicted 1234
2 SASI_Mm01_00128289 predicted 1458
3 SASI_Mm01_00128290 predicted 1154
4 SASI_Mm01_00128291 predicted 1822
5 SASI_Mm01_00128293 predicted 2236
6 SASI_Mm02_00319938 predicted 2189
7 SASI_Mm01_00128296 predicted 1051
8 SASI_Mm02_00319939 predicted 1142
9 SASI_Mm02_00319940 predicted 722
10 SASI_Mm02_00319941 predicted 785
11 SASI_Mm01_00128292 predicted 2178
12 SASI_Mm01_00128294 predicted 2297
13 SASI_Mm01_00128295 predicted 1379
14 SASI_Mm01_00128297 predicted 924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011122
VALIDATED
PLOD1 MISSION shRNA Bacterial Glycerol Stock
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011122.3-1994s21c1
Sequence:CCGGACTACACTAGGGCCCAGTTTGCTCGAGCAAACTGGGCCCTAGTGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011122.3-1635s21c1
Sequence:CCGGCCAGACCACCCACCTACATAACTCGAGTTATGTAGGTGGGTGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011122.3-370s21c1
Sequence:CCGGGACAAGGAAGACCTGGTTATTCTCGAGAATAACCAGGTCTTCCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011122.3-1837s21c1
Sequence:CCGGTGGTCTCTGGGTGATAATAAGCTCGAGCTTATTATCACCCAGAGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011122.3-2736s21c1
Sequence:CCGGTTTATCACCAAGAGCAAATAGCTCGAGCTATTTGCTCTTGGTGATAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011122.3-2310s21c1
Sequence:CCGGGACCTATCTCATCGTTGACAACTCGAGTTGTCAACGATGAGATAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011122.1-2559s1c1
Sequence:CCGGCCCAGGATTCTGTTTCAAGTACTCGAGTACTTGAAACAGAATCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011122.1-1371s1c1
Sequence:CCGGCGTGCCTTATATCTCAAACATCTCGAGATGTTTGAGATATAAGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011122.1-360s1c1
Sequence:CCGGCCGGGAACTCTTAAAGAAGTTCTCGAGAACTTCTTTAAGAGTTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011122.1-1933s1c1
Sequence:CCGGGCCCAGTTTGATCTAGCCTTTCTCGAGAAAGGCTAGATCAAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011122.1-918s1c1
Sequence:CCGGGCCCACACCATTTCTATCCTTCTCGAGAAGGATAGAAATGGTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011122
VALIDATED
PLOD1 MISSION shRNA shRNA Plasmid DNA
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011122.3-1994s21c1
Sequence:CCGGACTACACTAGGGCCCAGTTTGCTCGAGCAAACTGGGCCCTAGTGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011122.3-1635s21c1
Sequence:CCGGCCAGACCACCCACCTACATAACTCGAGTTATGTAGGTGGGTGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011122.3-370s21c1
Sequence:CCGGGACAAGGAAGACCTGGTTATTCTCGAGAATAACCAGGTCTTCCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011122.3-1837s21c1
Sequence:CCGGTGGTCTCTGGGTGATAATAAGCTCGAGCTTATTATCACCCAGAGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011122.3-2736s21c1
Sequence:CCGGTTTATCACCAAGAGCAAATAGCTCGAGCTATTTGCTCTTGGTGATAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011122.3-2310s21c1
Sequence:CCGGGACCTATCTCATCGTTGACAACTCGAGTTGTCAACGATGAGATAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011122.1-2559s1c1
Sequence:CCGGCCCAGGATTCTGTTTCAAGTACTCGAGTACTTGAAACAGAATCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011122.1-1371s1c1
Sequence:CCGGCGTGCCTTATATCTCAAACATCTCGAGATGTTTGAGATATAAGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011122.1-360s1c1
Sequence:CCGGCCGGGAACTCTTAAAGAAGTTCTCGAGAACTTCTTTAAGAGTTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011122.1-1933s1c1
Sequence:CCGGGCCCAGTTTGATCTAGCCTTTCTCGAGAAAGGCTAGATCAAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011122.1-918s1c1
Sequence:CCGGGCCCACACCATTTCTATCCTTCTCGAGAAGGATAGAAATGGTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011122
VALIDATED
PLOD1 MISSION shRNA Lentiviral Transduction Particles
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011122.3-1994s21c1
Sequence:CCGGACTACACTAGGGCCCAGTTTGCTCGAGCAAACTGGGCCCTAGTGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011122.3-1635s21c1
Sequence:CCGGCCAGACCACCCACCTACATAACTCGAGTTATGTAGGTGGGTGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011122.3-370s21c1
Sequence:CCGGGACAAGGAAGACCTGGTTATTCTCGAGAATAACCAGGTCTTCCTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011122.3-1837s21c1
Sequence:CCGGTGGTCTCTGGGTGATAATAAGCTCGAGCTTATTATCACCCAGAGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011122.3-2736s21c1
Sequence:CCGGTTTATCACCAAGAGCAAATAGCTCGAGCTATTTGCTCTTGGTGATAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011122.3-2310s21c1
Sequence:CCGGGACCTATCTCATCGTTGACAACTCGAGTTGTCAACGATGAGATAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011122.1-2559s1c1
Sequence:CCGGCCCAGGATTCTGTTTCAAGTACTCGAGTACTTGAAACAGAATCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011122.1-1371s1c1
Sequence:CCGGCGTGCCTTATATCTCAAACATCTCGAGATGTTTGAGATATAAGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011122.1-360s1c1
Sequence:CCGGCCGGGAACTCTTAAAGAAGTTCTCGAGAACTTCTTTAAGAGTTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011122.1-1933s1c1
Sequence:CCGGGCCCAGTTTGATCTAGCCTTTCTCGAGAAAGGCTAGATCAAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011122.1-918s1c1
Sequence:CCGGGCCCACACCATTTCTATCCTTCTCGAGAAGGATAGAAATGGTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000302
VALIDATED
PLOD1 MISSION shRNA Bacterial Glycerol Stock
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000302.2-2407s21c1
Sequence:CCGGACCAATCAAAGAGATTCAAAGCTCGAGCTTTGAATCTCTTTGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000302.2-1032s21c1
Sequence:CCGGCCCAGAAACACATGCGACTTTCTCGAGAAAGTCGCATGTGTTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000302.2-1879s21c1
Sequence:CCGGGCCGACTATTGACATCCACATCTCGAGATGTGGATGTCAATAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000302.2-663s21c1
Sequence:CCGGAGAAGAGGGAGCAGATCAATACTCGAGTATTGATCTGCTCCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000302.2-1927s21c1
Sequence:CCGGGCACAAATTCCTGCTGGAGTACTCGAGTACTCCAGCAGGAATTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-1927s1c1
Sequence:CCGGGCACAAATTCCTGCTGGAGTACTCGAGTACTCCAGCAGGAATTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-746s1c1
Sequence:CCGGCTCAAGTTTGAAATGGGCCATCTCGAGATGGCCCATTTCAAACTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-1879s1c1
Sequence:CCGGGCCGACTATTGACATCCACATCTCGAGATGTGGATGTCAATAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-1032s1c1
Sequence:CCGGCCCAGAAACACATGCGACTTTCTCGAGAAAGTCGCATGTGTTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-1435s1c1
Sequence:CCGGGCCCTATATTTCAAACATCTACTCGAGTAGATGTTTGAAATATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000302
VALIDATED
PLOD1 MISSION shRNA shRNA Plasmid DNA
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000302.2-2407s21c1
Sequence:CCGGACCAATCAAAGAGATTCAAAGCTCGAGCTTTGAATCTCTTTGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000302.2-1032s21c1
Sequence:CCGGCCCAGAAACACATGCGACTTTCTCGAGAAAGTCGCATGTGTTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000302.2-1879s21c1
Sequence:CCGGGCCGACTATTGACATCCACATCTCGAGATGTGGATGTCAATAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000302.2-663s21c1
Sequence:CCGGAGAAGAGGGAGCAGATCAATACTCGAGTATTGATCTGCTCCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000302.2-1927s21c1
Sequence:CCGGGCACAAATTCCTGCTGGAGTACTCGAGTACTCCAGCAGGAATTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-1927s1c1
Sequence:CCGGGCACAAATTCCTGCTGGAGTACTCGAGTACTCCAGCAGGAATTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-746s1c1
Sequence:CCGGCTCAAGTTTGAAATGGGCCATCTCGAGATGGCCCATTTCAAACTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-1879s1c1
Sequence:CCGGGCCGACTATTGACATCCACATCTCGAGATGTGGATGTCAATAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-1032s1c1
Sequence:CCGGCCCAGAAACACATGCGACTTTCTCGAGAAAGTCGCATGTGTTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-1435s1c1
Sequence:CCGGGCCCTATATTTCAAACATCTACTCGAGTAGATGTTTGAAATATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000302
VALIDATED
PLOD1 MISSION shRNA Lentiviral Transduction Particles
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000302.2-2407s21c1
Sequence:CCGGACCAATCAAAGAGATTCAAAGCTCGAGCTTTGAATCTCTTTGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000302.2-1032s21c1
Sequence:CCGGCCCAGAAACACATGCGACTTTCTCGAGAAAGTCGCATGTGTTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000302.2-1879s21c1
Sequence:CCGGGCCGACTATTGACATCCACATCTCGAGATGTGGATGTCAATAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000302.2-663s21c1
Sequence:CCGGAGAAGAGGGAGCAGATCAATACTCGAGTATTGATCTGCTCCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000302.2-1927s21c1
Sequence:CCGGGCACAAATTCCTGCTGGAGTACTCGAGTACTCCAGCAGGAATTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-1927s1c1
Sequence:CCGGGCACAAATTCCTGCTGGAGTACTCGAGTACTCCAGCAGGAATTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-746s1c1
Sequence:CCGGCTCAAGTTTGAAATGGGCCATCTCGAGATGGCCCATTTCAAACTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-1879s1c1
Sequence:CCGGGCCGACTATTGACATCCACATCTCGAGATGTGGATGTCAATAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-1032s1c1
Sequence:CCGGCCCAGAAACACATGCGACTTTCTCGAGAAAGTCGCATGTGTTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000302.2-1435s1c1
Sequence:CCGGGCCCTATATTTCAAACATCTACTCGAGTAGATGTTTGAAATATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)