EMAIL THIS PAGE TO A FRIEND

PLOD2

procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2

96 Gene Product Result for
Synonyms: LH2 TLH
UniProtKB ID: O00469, Q59ED2, Q8N170
Gene ID:
Human(5352) Summary: The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(26432) procollagen lysine, 2-oxoglutarate 5-dioxygenase 2
Rat(300901) procollagen lysine, 2-oxoglutarate 5-dioxygenase 2
Zebrafish(100036767) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
Horse(100061030) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
chicken(424882) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
dog(485702) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
domestic cat(101085741) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
domestic guinea pig(100735218) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
naked mole-rat(101708679) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
cow(533642) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
sheep(101103613) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400213 Anti-PLOD2 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2103796 Anti-PLOD2 antibody produced in rabbit affinity isolated antibody bovine, rabbit, horse, pig, dog, human, rat, mouse
immunohistochemistry, western blot pricing
SAB1410976 Anti-PLOD2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011961 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011961 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011961 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000935 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000935 Rosetta Predictions human pricing
NM_182943 Rosetta Predictions human pricing
NM_175869 Rosetta Predictions rat pricing
NM_011961 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182202 predicted 695
2 SASI_Hs01_00182203 predicted 2578
3 SASI_Hs02_00303535 predicted 1046
4 SASI_Hs01_00182204 predicted 1097
5 SASI_Hs01_00182205 predicted 1015
6 SASI_Hs01_00182206 predicted 2399
7 SASI_Hs01_00182207 predicted 2683
8 SASI_Hs01_00182208 predicted 965
9 SASI_Hs01_00182210 predicted 2566
10 SASI_Hs02_00303536 predicted 626
11 SASI_Hs01_00182209 predicted 1763
12 SASI_Hs01_00182211 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117808 predicted 695
2 SASI_Hs01_00117809 predicted 2648
3 SASI_Hs02_00371075 predicted 1053
4 SASI_Hs01_00117810 predicted 1089
5 SASI_Hs01_00117811 predicted 1014
6 SASI_Hs01_00117812 predicted 2456
7 SASI_Hs01_00117813 predicted 2747
8 SASI_Hs01_00117814 predicted 969
9 SASI_Hs01_00117816 predicted 2630
10 SASI_Hs02_00371076 predicted 622
11 SASI_Hs01_00117815 predicted 1770
12 SASI_Hs01_00117817 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051053 predicted 2399
2 SASI_Rn01_00051056 predicted 1707
3 SASI_Rn01_00051057 predicted 1841
4 SASI_Rn01_00051058 predicted 2386
5 SASI_Rn01_00051059 predicted 1635
6 SASI_Rn01_00051060 predicted 1379
7 SASI_Rn02_00269553 predicted 2248
8 SASI_Rn02_00269554 predicted 804
9 SASI_Rn01_00051061 predicted 2212
10 SASI_Rn01_00051062 predicted 1410
11 SASI_Rn01_00051054 predicted 850
12 SASI_Rn01_00051055 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020406 predicted 851
2 SASI_Mm01_00020407 predicted 1412
3 SASI_Mm01_00020408 predicted 464
4 SASI_Mm02_00321837 predicted 2085
5 SASI_Mm01_00020409 predicted 1262
6 SASI_Mm01_00020412 predicted 1310
7 SASI_Mm01_00020413 predicted 1642
8 SASI_Mm02_00321838 predicted 1378
9 SASI_Mm01_00020414 predicted 1792
10 SASI_Mm01_00020415 predicted 1158
11 SASI_Mm01_00020410 predicted 561
12 SASI_Mm01_00020411 predicted 1377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011961
VALIDATED
PLOD2 MISSION shRNA Bacterial Glycerol Stock
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011961.3-2144s21c1
Sequence:CCGGAGGTCTTCGCAGGCTATTATACTCGAGTATAATAGCCTGCGAAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011961.1-2541s1c1
Sequence:CCGGGCCTGGTAATATGTTCTTATTCTCGAGAATAAGAACATATTACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011961.1-1874s1c1
Sequence:CCGGGCTTCATTTCATCCGAGAGTTCTCGAGAACTCTCGGATGAAATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011961.1-895s1c1
Sequence:CCGGCCAAGGTTACACTGGGTGTTTCTCGAGAAACACCCAGTGTAACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011961.1-1497s1c1
Sequence:CCGGGCTAGAGATATGGGTGTGTTTCTCGAGAAACACACCCATATCTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011961.1-238s1c1
Sequence:CCGGGCGGTGATGGAATGAACAGTACTCGAGTACTGTTCATTCCATCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011961.3-332s21c1
Sequence:CCGGGGCGCATCCCTGCAGATAAATCTCGAGATTTATCTGCAGGGATGCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011961.3-1689s21c1
Sequence:CCGGTGATAAGTTGGATCCCGATATCTCGAGATATCGGGATCCAACTTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011961.3-2770s21c1
Sequence:CCGGGCCTGGTAATATGTTCTTATTCTCGAGAATAAGAACATATTACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011961.3-2234s21c1
Sequence:CCGGACCACGATGCCTCAACCTTTACTCGAGTAAAGGTTGAGGCATCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011961.3-2026s21c1
Sequence:CCGGAGCCGCATATCGGGTGGTTATCTCGAGATAACCACCCGATATGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011961
VALIDATED
PLOD2 MISSION shRNA shRNA Plasmid DNA
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011961.3-2144s21c1
Sequence:CCGGAGGTCTTCGCAGGCTATTATACTCGAGTATAATAGCCTGCGAAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011961.1-2541s1c1
Sequence:CCGGGCCTGGTAATATGTTCTTATTCTCGAGAATAAGAACATATTACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011961.1-1874s1c1
Sequence:CCGGGCTTCATTTCATCCGAGAGTTCTCGAGAACTCTCGGATGAAATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011961.1-895s1c1
Sequence:CCGGCCAAGGTTACACTGGGTGTTTCTCGAGAAACACCCAGTGTAACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011961.1-1497s1c1
Sequence:CCGGGCTAGAGATATGGGTGTGTTTCTCGAGAAACACACCCATATCTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011961.1-238s1c1
Sequence:CCGGGCGGTGATGGAATGAACAGTACTCGAGTACTGTTCATTCCATCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011961.3-332s21c1
Sequence:CCGGGGCGCATCCCTGCAGATAAATCTCGAGATTTATCTGCAGGGATGCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011961.3-1689s21c1
Sequence:CCGGTGATAAGTTGGATCCCGATATCTCGAGATATCGGGATCCAACTTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011961.3-2770s21c1
Sequence:CCGGGCCTGGTAATATGTTCTTATTCTCGAGAATAAGAACATATTACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011961.3-2234s21c1
Sequence:CCGGACCACGATGCCTCAACCTTTACTCGAGTAAAGGTTGAGGCATCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011961.3-2026s21c1
Sequence:CCGGAGCCGCATATCGGGTGGTTATCTCGAGATAACCACCCGATATGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011961
VALIDATED
PLOD2 MISSION shRNA Lentiviral Transduction Particles
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011961.3-2144s21c1
Sequence:CCGGAGGTCTTCGCAGGCTATTATACTCGAGTATAATAGCCTGCGAAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011961.1-2541s1c1
Sequence:CCGGGCCTGGTAATATGTTCTTATTCTCGAGAATAAGAACATATTACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011961.1-1874s1c1
Sequence:CCGGGCTTCATTTCATCCGAGAGTTCTCGAGAACTCTCGGATGAAATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011961.1-895s1c1
Sequence:CCGGCCAAGGTTACACTGGGTGTTTCTCGAGAAACACCCAGTGTAACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011961.1-1497s1c1
Sequence:CCGGGCTAGAGATATGGGTGTGTTTCTCGAGAAACACACCCATATCTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011961.1-238s1c1
Sequence:CCGGGCGGTGATGGAATGAACAGTACTCGAGTACTGTTCATTCCATCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011961.3-332s21c1
Sequence:CCGGGGCGCATCCCTGCAGATAAATCTCGAGATTTATCTGCAGGGATGCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011961.3-1689s21c1
Sequence:CCGGTGATAAGTTGGATCCCGATATCTCGAGATATCGGGATCCAACTTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011961.3-2770s21c1
Sequence:CCGGGCCTGGTAATATGTTCTTATTCTCGAGAATAAGAACATATTACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011961.3-2234s21c1
Sequence:CCGGACCACGATGCCTCAACCTTTACTCGAGTAAAGGTTGAGGCATCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011961.3-2026s21c1
Sequence:CCGGAGCCGCATATCGGGTGGTTATCTCGAGATAACCACCCGATATGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000935
VALIDATED
PLOD2 MISSION shRNA Bacterial Glycerol Stock
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000935.1-160s1c1
Sequence:CCGGCGATTTATGCAGTCAGCCAAACTCGAGTTTGGCTGACTGCATAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000935.1-1894s1c1
Sequence:CCGGCCAGTTACACTGAAGGTCTTTCTCGAGAAAGACCTTCAGTGTAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000935.1-1243s1c1
Sequence:CCGGGCTCCTCTTGTAACTCGTCATCTCGAGATGACGAGTTACAAGAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000935.1-532s1c1
Sequence:CCGGCGTATAGTTCAACAATGGAATCTCGAGATTCCATTGTTGAACTATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000935.1-770s1c1
Sequence:CCGGCCACCAAGATTCTCCTGAATTCTCGAGAATTCAGGAGAATCTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000935
VALIDATED
PLOD2 MISSION shRNA shRNA Plasmid DNA
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000935.1-160s1c1
Sequence:CCGGCGATTTATGCAGTCAGCCAAACTCGAGTTTGGCTGACTGCATAAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000935.1-1894s1c1
Sequence:CCGGCCAGTTACACTGAAGGTCTTTCTCGAGAAAGACCTTCAGTGTAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000935.1-1243s1c1
Sequence:CCGGGCTCCTCTTGTAACTCGTCATCTCGAGATGACGAGTTACAAGAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000935.1-532s1c1
Sequence:CCGGCGTATAGTTCAACAATGGAATCTCGAGATTCCATTGTTGAACTATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000935.1-770s1c1
Sequence:CCGGCCACCAAGATTCTCCTGAATTCTCGAGAATTCAGGAGAATCTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000935
VALIDATED
PLOD2 MISSION shRNA Lentiviral Transduction Particles
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000935.1-160s1c1
Sequence:CCGGCGATTTATGCAGTCAGCCAAACTCGAGTTTGGCTGACTGCATAAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000935.1-1894s1c1
Sequence:CCGGCCAGTTACACTGAAGGTCTTTCTCGAGAAAGACCTTCAGTGTAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000935.1-1243s1c1
Sequence:CCGGGCTCCTCTTGTAACTCGTCATCTCGAGATGACGAGTTACAAGAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000935.1-532s1c1
Sequence:CCGGCGTATAGTTCAACAATGGAATCTCGAGATTCCATTGTTGAACTATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000935.1-770s1c1
Sequence:CCGGCCACCAAGATTCTCCTGAATTCTCGAGAATTCAGGAGAATCTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)