EMAIL THIS PAGE TO A FRIEND

PLOD3

procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3

71 Gene Product Result for
Synonyms: LH3
UniProtKB ID: O60568, B2R6W6, Q540C3
Gene ID:
Human(8985) Summary: The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. [provided by RefSeq, Jul 2008]
Mouse(26433) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Rat(288583) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
cow(514996) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
sheep(101121738) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
naked mole-rat(101701075) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
domestic guinea pig(100733225) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Zebrafish(556077) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
domestic cat(101089668) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Horse(100059479) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
dog(479730) procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011962 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011962 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011962 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001084 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001084 Rosetta Predictions human pricing
NM_178101 Rosetta Predictions rat pricing
NM_011962 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241346 predicted 706
2 SASI_Hs02_00317421 predicted 1826
3 SASI_Hs01_00241348 predicted 1031
4 SASI_Hs01_00241349 predicted 1224
5 SASI_Hs01_00241350 predicted 1860
6 SASI_Hs01_00241351 predicted 767
7 SASI_Hs01_00241352 predicted 1090
8 SASI_Hs01_00241353 predicted 1940
9 SASI_Hs01_00241354 predicted 1127
10 SASI_Hs01_00241355 predicted 826
11 SASI_Hs01_00241347 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055659 predicted 855
2 SASI_Rn01_00055661 predicted 1662
3 SASI_Rn01_00055662 predicted 1521
4 SASI_Rn01_00055663 predicted 967
5 SASI_Rn01_00055665 predicted 2324
6 SASI_Rn01_00055666 predicted 1852
7 SASI_Rn01_00055667 predicted 521
8 SASI_Rn01_00055668 predicted 1010
9 SASI_Rn02_00269629 predicted 2476
10 SASI_Rn02_00269630 predicted 1624
11 SASI_Rn01_00055660 predicted 717
12 SASI_Rn01_00055664 predicted 1603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321839 predicted 2501
2 SASI_Mm02_00321840 predicted 2214
3 SASI_Mm02_00321841 predicted 781
4 SASI_Mm02_00321842 predicted 1312
5 SASI_Mm02_00321843 predicted 2226
6 SASI_Mm02_00321844 predicted 1905
7 SASI_Mm02_00321845 predicted 1904
8 SASI_Mm02_00321846 predicted 2293
9 SASI_Mm02_00321847 predicted 1296
10 SASI_Mm02_00321848 predicted 2046
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011962
VALIDATED
PLOD3 MISSION shRNA Bacterial Glycerol Stock
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011962.2-2860s21c1
Sequence:CCGGCGATACATCATGGTGTCCTTTCTCGAGAAAGGACACCATGATGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011962.2-1161s21c1
Sequence:CCGGCTTCCTCAACTCTGGTGGATTCTCGAGAATCCACCAGAGTTGAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011962.2-2896s21c1
Sequence:CCGGTCAACCAGTCTGCCAAACCTTCTCGAGAAGGTTTGGCAGACTGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011962.2-2476s21c1
Sequence:CCGGGCTGGAGGATACGAGAATGTTCTCGAGAACATTCTCGTATCCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-1161s1c1
Sequence:CCGGCTTCCTCAACTCTGGTGGATTCTCGAGAATCCACCAGAGTTGAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-2896s1c1
Sequence:CCGGTCAACCAGTCTGCCAAACCTTCTCGAGAAGGTTTGGCAGACTGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-2860s1c1
Sequence:CCGGCGATACATCATGGTGTCCTTTCTCGAGAAAGGACACCATGATGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-2476s1c1
Sequence:CCGGGCTGGAGGATACGAGAATGTTCTCGAGAACATTCTCGTATCCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-780s1c1
Sequence:CCGGCCCAGACAAATTGCTGGTGATCTCGAGATCACCAGCAATTTGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011962.2-780s21c1
Sequence:CCGGCCCAGACAAATTGCTGGTGATCTCGAGATCACCAGCAATTTGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011962
VALIDATED
PLOD3 MISSION shRNA shRNA Plasmid DNA
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011962.2-2860s21c1
Sequence:CCGGCGATACATCATGGTGTCCTTTCTCGAGAAAGGACACCATGATGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011962.2-1161s21c1
Sequence:CCGGCTTCCTCAACTCTGGTGGATTCTCGAGAATCCACCAGAGTTGAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011962.2-2896s21c1
Sequence:CCGGTCAACCAGTCTGCCAAACCTTCTCGAGAAGGTTTGGCAGACTGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011962.2-2476s21c1
Sequence:CCGGGCTGGAGGATACGAGAATGTTCTCGAGAACATTCTCGTATCCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-1161s1c1
Sequence:CCGGCTTCCTCAACTCTGGTGGATTCTCGAGAATCCACCAGAGTTGAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-2896s1c1
Sequence:CCGGTCAACCAGTCTGCCAAACCTTCTCGAGAAGGTTTGGCAGACTGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-2860s1c1
Sequence:CCGGCGATACATCATGGTGTCCTTTCTCGAGAAAGGACACCATGATGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-2476s1c1
Sequence:CCGGGCTGGAGGATACGAGAATGTTCTCGAGAACATTCTCGTATCCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-780s1c1
Sequence:CCGGCCCAGACAAATTGCTGGTGATCTCGAGATCACCAGCAATTTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011962.2-780s21c1
Sequence:CCGGCCCAGACAAATTGCTGGTGATCTCGAGATCACCAGCAATTTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011962
VALIDATED
PLOD3 MISSION shRNA Lentiviral Transduction Particles
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011962.2-2860s21c1
Sequence:CCGGCGATACATCATGGTGTCCTTTCTCGAGAAAGGACACCATGATGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011962.2-1161s21c1
Sequence:CCGGCTTCCTCAACTCTGGTGGATTCTCGAGAATCCACCAGAGTTGAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011962.2-2896s21c1
Sequence:CCGGTCAACCAGTCTGCCAAACCTTCTCGAGAAGGTTTGGCAGACTGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011962.2-2476s21c1
Sequence:CCGGGCTGGAGGATACGAGAATGTTCTCGAGAACATTCTCGTATCCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-1161s1c1
Sequence:CCGGCTTCCTCAACTCTGGTGGATTCTCGAGAATCCACCAGAGTTGAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-2896s1c1
Sequence:CCGGTCAACCAGTCTGCCAAACCTTCTCGAGAAGGTTTGGCAGACTGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-2860s1c1
Sequence:CCGGCGATACATCATGGTGTCCTTTCTCGAGAAAGGACACCATGATGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-2476s1c1
Sequence:CCGGGCTGGAGGATACGAGAATGTTCTCGAGAACATTCTCGTATCCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011962.2-780s1c1
Sequence:CCGGCCCAGACAAATTGCTGGTGATCTCGAGATCACCAGCAATTTGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011962.2-780s21c1
Sequence:CCGGCCCAGACAAATTGCTGGTGATCTCGAGATCACCAGCAATTTGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001084
VALIDATED
PLOD3 MISSION shRNA Bacterial Glycerol Stock
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001084.4-762s21c1
Sequence:CCGGCCGGGAGGATATGATCATCATCTCGAGATGATGATCATATCCTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001084.4-2788s21c1
Sequence:CCGGTCCGCGTGCCTGAACTGAATACTCGAGTATTCAGTTCAGGCACGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001084.4-942s21c1
Sequence:CCGGCTTCCTCAATTCTGGTGGATTCTCGAGAATCCACCAGAATTGAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-2255s1c1
Sequence:CCGGGCGGTGATGAACTTTGTGGTTCTCGAGAACCACAAAGTTCATCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-1829s1c1
Sequence:CCGGCTGAGCAATCAGCATGAATTTCTCGAGAAATTCATGCTGATTGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-799s1c1
Sequence:CCGGCTTCCTCAATTCTGGTGGATTCTCGAGAATCCACCAGAATTGAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-2498s1c1
Sequence:CCGGCGCTACATCATGGTGTCCTTTCTCGAGAAAGGACACCATGATGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-619s1c1
Sequence:CCGGCCGGGAGGATATGATCATCATCTCGAGATGATGATCATATCCTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001084.4-1080s21c1
Sequence:CCGGCAGCCTTAATCTGGATCATAACTCGAGTTATGATCCAGATTAAGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001084.4-788s21c1
Sequence:CCGGTGGATAGCTACGACGTGATTCCTCGAGGAATCACGTCGTAGCTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001084
VALIDATED
PLOD3 MISSION shRNA shRNA Plasmid DNA
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001084.4-762s21c1
Sequence:CCGGCCGGGAGGATATGATCATCATCTCGAGATGATGATCATATCCTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001084.4-2788s21c1
Sequence:CCGGTCCGCGTGCCTGAACTGAATACTCGAGTATTCAGTTCAGGCACGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001084.4-942s21c1
Sequence:CCGGCTTCCTCAATTCTGGTGGATTCTCGAGAATCCACCAGAATTGAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-2255s1c1
Sequence:CCGGGCGGTGATGAACTTTGTGGTTCTCGAGAACCACAAAGTTCATCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-1829s1c1
Sequence:CCGGCTGAGCAATCAGCATGAATTTCTCGAGAAATTCATGCTGATTGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-799s1c1
Sequence:CCGGCTTCCTCAATTCTGGTGGATTCTCGAGAATCCACCAGAATTGAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-2498s1c1
Sequence:CCGGCGCTACATCATGGTGTCCTTTCTCGAGAAAGGACACCATGATGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-619s1c1
Sequence:CCGGCCGGGAGGATATGATCATCATCTCGAGATGATGATCATATCCTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001084.4-1080s21c1
Sequence:CCGGCAGCCTTAATCTGGATCATAACTCGAGTTATGATCCAGATTAAGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001084.4-788s21c1
Sequence:CCGGTGGATAGCTACGACGTGATTCCTCGAGGAATCACGTCGTAGCTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001084
VALIDATED
PLOD3 MISSION shRNA Lentiviral Transduction Particles
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001084.4-762s21c1
Sequence:CCGGCCGGGAGGATATGATCATCATCTCGAGATGATGATCATATCCTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001084.4-2788s21c1
Sequence:CCGGTCCGCGTGCCTGAACTGAATACTCGAGTATTCAGTTCAGGCACGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001084.4-942s21c1
Sequence:CCGGCTTCCTCAATTCTGGTGGATTCTCGAGAATCCACCAGAATTGAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-2255s1c1
Sequence:CCGGGCGGTGATGAACTTTGTGGTTCTCGAGAACCACAAAGTTCATCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-1829s1c1
Sequence:CCGGCTGAGCAATCAGCATGAATTTCTCGAGAAATTCATGCTGATTGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-799s1c1
Sequence:CCGGCTTCCTCAATTCTGGTGGATTCTCGAGAATCCACCAGAATTGAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-2498s1c1
Sequence:CCGGCGCTACATCATGGTGTCCTTTCTCGAGAAAGGACACCATGATGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001084.3-619s1c1
Sequence:CCGGCCGGGAGGATATGATCATCATCTCGAGATGATGATCATATCCTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001084.4-1080s21c1
Sequence:CCGGCAGCCTTAATCTGGATCATAACTCGAGTTATGATCCAGATTAAGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001084.4-788s21c1
Sequence:CCGGTGGATAGCTACGACGTGATTCCTCGAGGAATCACGTCGTAGCTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)