EMAIL THIS PAGE TO A FRIEND

PLP1

proteolipid protein 1

186 Gene Product Result for
Synonyms: GPM6C HLD1 MMPL PLP PLP/DM20 PMD SPG2
UniProtKB ID: P60201, P04400, P06905, Q502Y1, Q6FHZ6
Gene ID:
Human(5354) Summary: This gene encodes a transmembrane proteolipid protein that is the predominant myelin protein present in the central nervous system. It may play a role in the compaction, stabilization, and maintenance of myelin sheaths, as well as in oligodendrocyte development and axonal survival. Mutations in this gene cause X-linked Pelizaeus-Merzbacher disease and spastic paraplegia type 2. Alternatively spliced transcript variants encoding distinct isoforms or having different 5' UTRs, have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(18823) proteolipid protein (myelin) 1
Rat(24943) proteolipid protein 1
Thale Cress(829861) patatin-related phospholipase A
dog(481002) proteolipid protein 1
domestic cat(101098610) proteolipid protein 1
chicken(396214) proteolipid protein 1
domestic guinea pig(100714212) proteolipid protein 1
naked mole-rat(101699252) proteolipid protein 1
Domestic Rabbit(100009169) proteolipid protein 1
cow(281410) proteolipid protein 1
sheep(101121072) proteolipid protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011123 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011123 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011123 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000533 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067901 MISSION® esiRNA esiRNA human PLP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000533 Rosetta Predictions human pricing
NM_199478 Rosetta Predictions human pricing
NM_030990 Rosetta Predictions rat pricing
NM_011123 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233916 predicted 1105
2 SASI_Hs01_00233917 predicted 1146
3 SASI_Hs01_00233918 predicted 1237
4 SASI_Hs01_00233919 predicted 1314
5 SASI_Hs01_00233920 predicted 955
6 SASI_Hs01_00233921 predicted 1270
7 SASI_Hs02_00302746 predicted 1394
8 SASI_Hs01_00233923 predicted 1039
9 SASI_Hs01_00233924 predicted 1450
10 SASI_Hs01_00233925 predicted 1246
11 SASI_Hs01_00233922 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188311 predicted 995
2 SASI_Hs01_00188312 predicted 1320
3 SASI_Hs01_00188314 predicted 1131
4 SASI_Hs01_00188315 predicted 997
5 SASI_Hs01_00188316 predicted 1213
6 SASI_Hs01_00188317 predicted 849
7 SASI_Hs02_00372872 predicted 1233
8 SASI_Hs01_00188318 predicted 1283
9 SASI_Hs01_00188319 predicted 926
10 SASI_Hs01_00188320 predicted 1348
11 SASI_Hs01_00188313 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076175 predicted 1005
2 SASI_Rn01_00076176 predicted 289
3 SASI_Rn01_00076177 predicted 416
4 SASI_Rn01_00076178 predicted 496
5 SASI_Rn01_00076179 predicted 773
6 SASI_Rn01_00076180 predicted 1042
7 SASI_Rn01_00076181 predicted 289
8 SASI_Rn01_00076182 predicted 296
9 SASI_Rn01_00076183 predicted 909
10 SASI_Rn01_00076184 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011123 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195471 predicted 243
2 SASI_Mm01_00195472 predicted 621
3 SASI_Mm01_00195473 predicted 367
4 SASI_Mm01_00195474 predicted 457
5 SASI_Mm01_00195475 predicted 866
6 SASI_Mm01_00195476 predicted 247
7 SASI_Mm01_00195477 predicted 247
8 SASI_Mm01_00195478 predicted 726
9 SASI_Mm01_00195479 predicted 265
10 SASI_Mm01_00195480 predicted 539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011123
PLP1 MISSION shRNA Bacterial Glycerol Stock
proteolipid protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000090337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011123.1-530s1c1
Sequence:CCGGGCCAACATCAAGCTCATTCTTCTCGAGAAGAATGAGCTTGATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011123.1-2192s1c1
Sequence:CCGGCCCATGAAATTATTGGGAATTCTCGAGAATTCCCAATAATTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011123.1-346s1c1
Sequence:CCGGGCTTTCCAGTATGTCATCTATCTCGAGATAGATGACATACTGGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011123.1-859s1c1
Sequence:CCGGCACCTGTTTATTGCTGCGTTTCTCGAGAAACGCAGCAATAAACAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011123
PLP1 MISSION shRNA shRNA Plasmid DNA
proteolipid protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000090337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011123.1-530s1c1
Sequence:CCGGGCCAACATCAAGCTCATTCTTCTCGAGAAGAATGAGCTTGATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011123.1-2192s1c1
Sequence:CCGGCCCATGAAATTATTGGGAATTCTCGAGAATTCCCAATAATTTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011123.1-346s1c1
Sequence:CCGGGCTTTCCAGTATGTCATCTATCTCGAGATAGATGACATACTGGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011123.1-859s1c1
Sequence:CCGGCACCTGTTTATTGCTGCGTTTCTCGAGAAACGCAGCAATAAACAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011123
PLP1 MISSION shRNA Lentiviral Transduction Particles
proteolipid protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000090337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011123.1-530s1c1
Sequence:CCGGGCCAACATCAAGCTCATTCTTCTCGAGAAGAATGAGCTTGATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011123.1-2192s1c1
Sequence:CCGGCCCATGAAATTATTGGGAATTCTCGAGAATTCCCAATAATTTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011123.1-346s1c1
Sequence:CCGGGCTTTCCAGTATGTCATCTATCTCGAGATAGATGACATACTGGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011123.1-859s1c1
Sequence:CCGGCACCTGTTTATTGCTGCGTTTCTCGAGAAACGCAGCAATAAACAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000533
PLP1 MISSION shRNA Bacterial Glycerol Stock
proteolipid protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000533.3-937s1c1
Sequence:CCGGCCTTCATGATTGCTGCCACTTCTCGAGAAGTGGCAGCAATCATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000533.3-1970s1c1
Sequence:CCGGCCTCTGTCATATCTTCACAATCTCGAGATTGTGAAGATATGACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000533.3-339s1c1
Sequence:CCGGGACTATGAGTATCTCATCAATCTCGAGATTGATGAGATACTCATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000533.3-955s1c1
Sequence:CCGGCTTACAACTTTGCCGTCCTTACTCGAGTAAGGACGGCAAAGTTGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000533.3-464s1c1
Sequence:CCGGGCAGATCTTTGGCGACTACAACTCGAGTTGTAGTCGCCAAAGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000533.3-607s21c1
Sequence:CCGGTAGGACATCCCGACAAGTTTGCTCGAGCAAACTTGTCGGGATGTCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000533.3-576s21c1
Sequence:CCGGGAGCGGGTGTGTCATTGTTTGCTCGAGCAAACAATGACACACCCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000533.3-1139s21c1
Sequence:CCGGGAGAGTCTTGCAGTGATTAAGCTCGAGCTTAATCACTGCAAGACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000533
PLP1 MISSION shRNA shRNA Plasmid DNA
proteolipid protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000533.3-937s1c1
Sequence:CCGGCCTTCATGATTGCTGCCACTTCTCGAGAAGTGGCAGCAATCATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000533.3-1970s1c1
Sequence:CCGGCCTCTGTCATATCTTCACAATCTCGAGATTGTGAAGATATGACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000533.3-339s1c1
Sequence:CCGGGACTATGAGTATCTCATCAATCTCGAGATTGATGAGATACTCATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000533.3-955s1c1
Sequence:CCGGCTTACAACTTTGCCGTCCTTACTCGAGTAAGGACGGCAAAGTTGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000533.3-464s1c1
Sequence:CCGGGCAGATCTTTGGCGACTACAACTCGAGTTGTAGTCGCCAAAGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000533.3-607s21c1
Sequence:CCGGTAGGACATCCCGACAAGTTTGCTCGAGCAAACTTGTCGGGATGTCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000533.3-576s21c1
Sequence:CCGGGAGCGGGTGTGTCATTGTTTGCTCGAGCAAACAATGACACACCCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000533.3-1139s21c1
Sequence:CCGGGAGAGTCTTGCAGTGATTAAGCTCGAGCTTAATCACTGCAAGACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000533
PLP1 MISSION shRNA Lentiviral Transduction Particles
proteolipid protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000533.3-937s1c1
Sequence:CCGGCCTTCATGATTGCTGCCACTTCTCGAGAAGTGGCAGCAATCATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000533.3-1970s1c1
Sequence:CCGGCCTCTGTCATATCTTCACAATCTCGAGATTGTGAAGATATGACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000533.3-339s1c1
Sequence:CCGGGACTATGAGTATCTCATCAATCTCGAGATTGATGAGATACTCATAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000533.3-955s1c1
Sequence:CCGGCTTACAACTTTGCCGTCCTTACTCGAGTAAGGACGGCAAAGTTGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000533.3-464s1c1
Sequence:CCGGGCAGATCTTTGGCGACTACAACTCGAGTTGTAGTCGCCAAAGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000533.3-607s21c1
Sequence:CCGGTAGGACATCCCGACAAGTTTGCTCGAGCAAACTTGTCGGGATGTCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000533.3-576s21c1
Sequence:CCGGGAGCGGGTGTGTCATTGTTTGCTCGAGCAAACAATGACACACCCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000533.3-1139s21c1
Sequence:CCGGGAGAGTCTTGCAGTGATTAAGCTCGAGCTTAATCACTGCAAGACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)