EMAIL THIS PAGE TO A FRIEND

PLRG1

pleiotropic regulator 1

63 Gene Product Result for
Synonyms: Cwc1 PRL1 PRP46 PRPF46 TANGO4
UniProtKB ID: O43660, B3KMK4, Q3KQY5, Q8WUD8
Gene ID:
Human(5356) Summary: This gene encodes a core component of the cell division cycle 5-like (CDC5L) complex. The CDC5L complex is part of the spliceosome and is required for pre-mRNA splicing. The encoded protein plays a critical role in alternative splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(53317) pleiotropic regulator 1, PRL1 homolog (Arabidopsis)
Rat(60376) pleiotropic regulator 1
Zebrafish(100004402) pleiotropic regulator 1
domestic cat(101093180) pleiotropic regulator 1
Horse(100062153) pleiotropic regulator 1
dog(612490) pleiotropic regulator 1
chicken(422401) pleiotropic regulator 1
domestic guinea pig(100722659) pleiotropic regulator 1
naked mole-rat(101726396) pleiotropic regulator 1
Domestic Rabbit(100350581) pleiotropic regulator 1
cow(533951) pleiotropic regulator 1
sheep(101102933) pleiotropic regulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002669 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002669 Rosetta Predictions human pricing
NM_021757 Rosetta Predictions rat pricing
NM_016784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073241 predicted 1347
2 SASI_Hs01_00073242 predicted 782
3 SASI_Hs01_00073243 predicted 1014
4 SASI_Hs01_00073244 predicted 206
5 SASI_Hs01_00073245 predicted 433
6 SASI_Hs01_00073246 predicted 633
7 SASI_Hs01_00073247 predicted 1039
8 SASI_Hs01_00073248 predicted 968
9 SASI_Hs01_00073249 predicted 539
10 SASI_Hs01_00073250 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262815 predicted 1379
2 SASI_Rn01_00088783 predicted 461
3 SASI_Rn01_00088785 predicted 1220
4 SASI_Rn01_00088786 predicted 957
5 SASI_Rn01_00088787 predicted 1186
6 SASI_Rn01_00088788 predicted 950
7 SASI_Rn01_00088789 predicted 332
8 SASI_Rn01_00088790 predicted 694
9 SASI_Rn02_00262816 predicted 668
10 SASI_Rn01_00088792 predicted 338
11 SASI_Rn01_00088784 predicted 576
12 SASI_Rn01_00088791 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070908 predicted 611
2 SASI_Mm01_00070909 predicted 1235
3 SASI_Mm01_00070910 predicted 1055
4 SASI_Mm01_00070911 predicted 958
5 SASI_Mm01_00070912 predicted 966
6 SASI_Mm01_00070913 predicted 443
7 SASI_Mm01_00070914 predicted 580
8 SASI_Mm01_00070915 predicted 1152
9 SASI_Mm01_00070916 predicted 364
10 SASI_Mm01_00070917 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016784
VALIDATED
PLRG1 MISSION shRNA Bacterial Glycerol Stock
pleiotropic regulator 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-746s1c1
Sequence:CCGGCCTGGAAATCAGTGGTTCGTTCTCGAGAACGAACCACTGATTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-583s1c1
Sequence:CCGGGCCCACAGCAATGAATTCTATCTCGAGATAGAATTCATTGCTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-510s1c1
Sequence:CCGGCCAGAGTTGATGCAAATCGTACTCGAGTACGATTTGCATCAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-684s1c1
Sequence:CCGGCGTGGAAACTCTACAGGGTTACTCGAGTAACCCTGTAGAGTTTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-1520s1c1
Sequence:CCGGCGGTCAGAAAGTCGGTTACTACTCGAGTAGTAACCGACTTTCTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016784.3-1519s21c1
Sequence:CCGGCGGTCAGAAAGTCGGTTACTACTCGAGTAGTAACCGACTTTCTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016784.3-582s21c1
Sequence:CCGGGCCCACAGCAATGAATTCTATCTCGAGATAGAATTCATTGCTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016784.3-745s21c1
Sequence:CCGGCCTGGAAATCAGTGGTTCGTTCTCGAGAACGAACCACTGATTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016784.3-683s21c1
Sequence:CCGGCGTGGAAACTCTACAGGGTTACTCGAGTAACCCTGTAGAGTTTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016784.3-509s21c1
Sequence:CCGGCCAGAGTTGATGCAAATCGTACTCGAGTACGATTTGCATCAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016784
VALIDATED
PLRG1 MISSION shRNA shRNA Plasmid DNA
pleiotropic regulator 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-746s1c1
Sequence:CCGGCCTGGAAATCAGTGGTTCGTTCTCGAGAACGAACCACTGATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-583s1c1
Sequence:CCGGGCCCACAGCAATGAATTCTATCTCGAGATAGAATTCATTGCTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-510s1c1
Sequence:CCGGCCAGAGTTGATGCAAATCGTACTCGAGTACGATTTGCATCAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-684s1c1
Sequence:CCGGCGTGGAAACTCTACAGGGTTACTCGAGTAACCCTGTAGAGTTTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-1520s1c1
Sequence:CCGGCGGTCAGAAAGTCGGTTACTACTCGAGTAGTAACCGACTTTCTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016784.3-1519s21c1
Sequence:CCGGCGGTCAGAAAGTCGGTTACTACTCGAGTAGTAACCGACTTTCTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016784.3-582s21c1
Sequence:CCGGGCCCACAGCAATGAATTCTATCTCGAGATAGAATTCATTGCTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016784.3-745s21c1
Sequence:CCGGCCTGGAAATCAGTGGTTCGTTCTCGAGAACGAACCACTGATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016784.3-683s21c1
Sequence:CCGGCGTGGAAACTCTACAGGGTTACTCGAGTAACCCTGTAGAGTTTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016784.3-509s21c1
Sequence:CCGGCCAGAGTTGATGCAAATCGTACTCGAGTACGATTTGCATCAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016784
VALIDATED
PLRG1 MISSION shRNA Lentiviral Transduction Particles
pleiotropic regulator 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-746s1c1
Sequence:CCGGCCTGGAAATCAGTGGTTCGTTCTCGAGAACGAACCACTGATTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-583s1c1
Sequence:CCGGGCCCACAGCAATGAATTCTATCTCGAGATAGAATTCATTGCTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-510s1c1
Sequence:CCGGCCAGAGTTGATGCAAATCGTACTCGAGTACGATTTGCATCAACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-684s1c1
Sequence:CCGGCGTGGAAACTCTACAGGGTTACTCGAGTAACCCTGTAGAGTTTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016784.2-1520s1c1
Sequence:CCGGCGGTCAGAAAGTCGGTTACTACTCGAGTAGTAACCGACTTTCTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016784.3-1519s21c1
Sequence:CCGGCGGTCAGAAAGTCGGTTACTACTCGAGTAGTAACCGACTTTCTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016784.3-582s21c1
Sequence:CCGGGCCCACAGCAATGAATTCTATCTCGAGATAGAATTCATTGCTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016784.3-745s21c1
Sequence:CCGGCCTGGAAATCAGTGGTTCGTTCTCGAGAACGAACCACTGATTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016784.3-683s21c1
Sequence:CCGGCGTGGAAACTCTACAGGGTTACTCGAGTAACCCTGTAGAGTTTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016784.3-509s21c1
Sequence:CCGGCCAGAGTTGATGCAAATCGTACTCGAGTACGATTTGCATCAACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002669
VALIDATED
PLRG1 MISSION shRNA Bacterial Glycerol Stock
pleiotropic regulator 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002669.1-844s1c1
Sequence:CCGGCGGCATTATCATGGACATTTACTCGAGTAAATGTCCATGATAATGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002669.1-247s1c1
Sequence:CCGGCCTGCCAATCAAGGACAAGAACTCGAGTTCTTGTCCTTGATTGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002669.1-1047s1c1
Sequence:CCGGCCATGATACTACAATTCGATTCTCGAGAATCGAATTGTAGTATCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002669.2-1474s21c1
Sequence:CCGGGATCAGTCTGAAAGTCGATTACTCGAGTAATCGACTTTCAGACTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002669.2-1204s21c1
Sequence:CCGACATCCAAGACATTACACATTTCTCGAGAAATGTGTAATGTCTTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002669.2-757s21c1
Sequence:CCGGGACTTGGCTAGTGGCAAATTACTCGAGTAATTTGCCACTAGCCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002669.2-782s21c1
Sequence:CCGGTGTCATTGACTGGGCATATTACTCGAGTAATATGCCCAGTCAATGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002669
VALIDATED
PLRG1 MISSION shRNA shRNA Plasmid DNA
pleiotropic regulator 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002669.1-844s1c1
Sequence:CCGGCGGCATTATCATGGACATTTACTCGAGTAAATGTCCATGATAATGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002669.1-247s1c1
Sequence:CCGGCCTGCCAATCAAGGACAAGAACTCGAGTTCTTGTCCTTGATTGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002669.1-1047s1c1
Sequence:CCGGCCATGATACTACAATTCGATTCTCGAGAATCGAATTGTAGTATCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002669.2-1474s21c1
Sequence:CCGGGATCAGTCTGAAAGTCGATTACTCGAGTAATCGACTTTCAGACTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002669.2-1204s21c1
Sequence:CCGACATCCAAGACATTACACATTTCTCGAGAAATGTGTAATGTCTTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002669.2-757s21c1
Sequence:CCGGGACTTGGCTAGTGGCAAATTACTCGAGTAATTTGCCACTAGCCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002669.2-782s21c1
Sequence:CCGGTGTCATTGACTGGGCATATTACTCGAGTAATATGCCCAGTCAATGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002669
VALIDATED
PLRG1 MISSION shRNA Lentiviral Transduction Particles
pleiotropic regulator 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002669.1-844s1c1
Sequence:CCGGCGGCATTATCATGGACATTTACTCGAGTAAATGTCCATGATAATGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002669.1-247s1c1
Sequence:CCGGCCTGCCAATCAAGGACAAGAACTCGAGTTCTTGTCCTTGATTGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002669.1-1047s1c1
Sequence:CCGGCCATGATACTACAATTCGATTCTCGAGAATCGAATTGTAGTATCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002669.2-1474s21c1
Sequence:CCGGGATCAGTCTGAAAGTCGATTACTCGAGTAATCGACTTTCAGACTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002669.2-1204s21c1
Sequence:CCGACATCCAAGACATTACACATTTCTCGAGAAATGTGTAATGTCTTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002669.2-757s21c1
Sequence:CCGGGACTTGGCTAGTGGCAAATTACTCGAGTAATTTGCCACTAGCCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002669.2-782s21c1
Sequence:CCGGTGTCATTGACTGGGCATATTACTCGAGTAATATGCCCAGTCAATGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)