EMAIL THIS PAGE TO A FRIEND

PLS1

plastin 1

102 Gene Product Result for
UniProtKB ID: Q14651, A8K2Q1, D3DNG3, Q8NEG6
Gene ID:
Human(5357) Summary: Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Feb 2010]
Mouse(102502) plastin 1 (I-isoform)
Rat(315926) plastin 1
Zebrafish(334273) plastin 1 (I isoform)
Horse(100051261) plastin 1
dog(485697) plastin 1
chicken(396291) plastin 1
cow(616560) plastin 1
sheep(101105619) plastin 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002670 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_110660 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_110660 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_110660 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002670 Rosetta Predictions human pricing
NM_001108178 Rosetta Predictions rat pricing
NM_001033210 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063846 predicted 1406
2 SASI_Hs01_00063847 predicted 1920
3 SASI_Hs01_00063848 predicted 1557
4 SASI_Hs01_00063849 predicted 888
5 SASI_Hs01_00063850 predicted 532
6 SASI_Hs01_00063851 predicted 624
7 SASI_Hs02_00334237 predicted 1742
8 SASI_Hs01_00063852 predicted 2065
9 SASI_Hs01_00063854 predicted 500
10 SASI_Hs02_00334238 predicted 729
11 SASI_Hs01_00063853 predicted 1417
12 SASI_Hs01_00063855 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236104 predicted 1030
2 SASI_Rn02_00236105 predicted 854
3 SASI_Rn02_00236106 predicted 1168
4 SASI_Rn02_00236107 predicted 498
5 SASI_Rn02_00236108 predicted 900
6 SASI_Rn02_00236109 predicted 946
7 SASI_Rn02_00236110 predicted 1400
8 SASI_Rn02_00236111 predicted 1195
9 SASI_Rn02_00236112 predicted 1149
10 SASI_Rn02_00236113 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033210 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070633 predicted 1810
2 SASI_Mm01_00070634 predicted 1861
3 SASI_Mm01_00070636 predicted 205
4 SASI_Mm02_00288335 predicted 1676
5 SASI_Mm01_00070637 predicted 1779
6 SASI_Mm01_00070638 predicted 1259
7 SASI_Mm02_00288336 predicted 1747
8 SASI_Mm01_00070639 predicted 197
9 SASI_Mm01_00070641 predicted 530
10 SASI_Mm01_00070642 predicted 1430
11 SASI_Mm01_00070635 predicted 1023
12 SASI_Mm01_00070640 predicted 1535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002670
VALIDATED
PLS1 MISSION shRNA Bacterial Glycerol Stock
plastin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002670.2-732s21c1
Sequence:CCGGAGCTCACGCCATTCACTATTTCTCGAGAAATAGTGAATGGCGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002670.2-1304s21c1
Sequence:CCGGTGCCTGCACAAGCCGAATAATCTCGAGATTATTCGGCTTGTGCAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002670.2-2334s21c1
Sequence:CCGGTCGTATTAGACAAGACTAAATCTCGAGATTTAGTCTTGTCTAATACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002670.2-1834s21c1
Sequence:CCGGCCTAGATTTAATAGATGCCATCTCGAGATGGCATCTATTAAATCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002670.1-514s1c1
Sequence:CCGGCCCTGACTGTAAGCATCTTATCTCGAGATAAGATGCTTACAGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002670.1-1756s1c1
Sequence:CCGGCCTAGATTTAATAGATGCCATCTCGAGATGGCATCTATTAAATCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002670.1-287s1c1
Sequence:CCGGGACAGCAACAAAGATGGCAAACTCGAGTTTGCCATCTTTGTTGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002670.1-1855s1c1
Sequence:CCGGCGCCATTTCAGTTGCTCGAAACTCGAGTTTCGAGCAACTGAAATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002670.1-1420s1c1
Sequence:CCGGCCATGTCAACAAACCTCCTTACTCGAGTAAGGAGGTTTGTTGACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002670.2-592s21c1
Sequence:CCGGCCCTGACTGTAAGCATCTTATCTCGAGATAAGATGCTTACAGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002670
VALIDATED
PLS1 MISSION shRNA shRNA Plasmid DNA
plastin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002670.2-732s21c1
Sequence:CCGGAGCTCACGCCATTCACTATTTCTCGAGAAATAGTGAATGGCGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002670.2-1304s21c1
Sequence:CCGGTGCCTGCACAAGCCGAATAATCTCGAGATTATTCGGCTTGTGCAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002670.2-2334s21c1
Sequence:CCGGTCGTATTAGACAAGACTAAATCTCGAGATTTAGTCTTGTCTAATACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002670.2-1834s21c1
Sequence:CCGGCCTAGATTTAATAGATGCCATCTCGAGATGGCATCTATTAAATCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002670.1-514s1c1
Sequence:CCGGCCCTGACTGTAAGCATCTTATCTCGAGATAAGATGCTTACAGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002670.1-1756s1c1
Sequence:CCGGCCTAGATTTAATAGATGCCATCTCGAGATGGCATCTATTAAATCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002670.1-287s1c1
Sequence:CCGGGACAGCAACAAAGATGGCAAACTCGAGTTTGCCATCTTTGTTGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002670.1-1855s1c1
Sequence:CCGGCGCCATTTCAGTTGCTCGAAACTCGAGTTTCGAGCAACTGAAATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002670.1-1420s1c1
Sequence:CCGGCCATGTCAACAAACCTCCTTACTCGAGTAAGGAGGTTTGTTGACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002670.2-592s21c1
Sequence:CCGGCCCTGACTGTAAGCATCTTATCTCGAGATAAGATGCTTACAGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002670
VALIDATED
PLS1 MISSION shRNA Lentiviral Transduction Particles
plastin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002670.2-732s21c1
Sequence:CCGGAGCTCACGCCATTCACTATTTCTCGAGAAATAGTGAATGGCGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002670.2-1304s21c1
Sequence:CCGGTGCCTGCACAAGCCGAATAATCTCGAGATTATTCGGCTTGTGCAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002670.2-2334s21c1
Sequence:CCGGTCGTATTAGACAAGACTAAATCTCGAGATTTAGTCTTGTCTAATACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002670.2-1834s21c1
Sequence:CCGGCCTAGATTTAATAGATGCCATCTCGAGATGGCATCTATTAAATCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002670.1-514s1c1
Sequence:CCGGCCCTGACTGTAAGCATCTTATCTCGAGATAAGATGCTTACAGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002670.1-1756s1c1
Sequence:CCGGCCTAGATTTAATAGATGCCATCTCGAGATGGCATCTATTAAATCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002670.1-287s1c1
Sequence:CCGGGACAGCAACAAAGATGGCAAACTCGAGTTTGCCATCTTTGTTGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002670.1-1855s1c1
Sequence:CCGGCGCCATTTCAGTTGCTCGAAACTCGAGTTTCGAGCAACTGAAATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002670.1-1420s1c1
Sequence:CCGGCCATGTCAACAAACCTCCTTACTCGAGTAAGGAGGTTTGTTGACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002670.2-592s21c1
Sequence:CCGGCCCTGACTGTAAGCATCTTATCTCGAGATAAGATGCTTACAGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_110660
VALIDATED
PLS1 MISSION shRNA Bacterial Glycerol Stock
plastin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-277s1c1
Sequence:CCGGCAGTGGATATGTTAGTGACTACTCGAGTAGTCACTAACATATCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-1432s1c1
Sequence:CCGGCCCGTACATCAATCACCTGTACTCGAGTACAGGTGATTGATGTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-2920s1c1
Sequence:CCGGCCAGCCGTTAAGTATTTATTTCTCGAGAAATAAATACTTAACGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-1202s1c1
Sequence:CCGGGCTGGATTTATGCTCCAGGAACTCGAGTTCCTGGAGCATAAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-1072s1c1
Sequence:CCGGCCAGGACATCAAGGATTCAAACTCGAGTTTGAATCCTTGATGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_110660
VALIDATED
PLS1 MISSION shRNA shRNA Plasmid DNA
plastin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-277s1c1
Sequence:CCGGCAGTGGATATGTTAGTGACTACTCGAGTAGTCACTAACATATCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-1432s1c1
Sequence:CCGGCCCGTACATCAATCACCTGTACTCGAGTACAGGTGATTGATGTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-2920s1c1
Sequence:CCGGCCAGCCGTTAAGTATTTATTTCTCGAGAAATAAATACTTAACGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-1202s1c1
Sequence:CCGGGCTGGATTTATGCTCCAGGAACTCGAGTTCCTGGAGCATAAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-1072s1c1
Sequence:CCGGCCAGGACATCAAGGATTCAAACTCGAGTTTGAATCCTTGATGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_110660
VALIDATED
PLS1 MISSION shRNA Lentiviral Transduction Particles
plastin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-277s1c1
Sequence:CCGGCAGTGGATATGTTAGTGACTACTCGAGTAGTCACTAACATATCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-1432s1c1
Sequence:CCGGCCCGTACATCAATCACCTGTACTCGAGTACAGGTGATTGATGTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-2920s1c1
Sequence:CCGGCCAGCCGTTAAGTATTTATTTCTCGAGAAATAAATACTTAACGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-1202s1c1
Sequence:CCGGGCTGGATTTATGCTCCAGGAACTCGAGTTCCTGGAGCATAAATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110660.6-1072s1c1
Sequence:CCGGCCAGGACATCAAGGATTCAAACTCGAGTTTGAATCCTTGATGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)