EMAIL THIS PAGE TO A FRIEND

PLS3

plastin 3

143 Gene Product Result for
Synonyms: T-plastin
UniProtKB ID: P13797, A8K579, B1AQ09, Q86YI6
Gene ID:
Human(5358) Summary: Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). The C-terminal 570 amino acids of the T-plastin and L-plastin proteins are 83% identical. It contains a potential calcium-binding site near the N terminus. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
Mouse(102866) plastin 3 (T-isoform)
Rat(81748) plastin 3
Zebrafish(436598) plastin 3 (T isoform)
chicken(422222) plastin 3
dog(481025) plastin 3
Horse(100053927) plastin 3
cow(505687) plastin 3
sheep(101107418) plastin 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145629 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145629 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145629 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005032 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005032 Rosetta Predictions human pricing
XM_001057425 Rosetta Predictions rat pricing
XM_001057538 Rosetta Predictions rat pricing
XM_343776 Rosetta Predictions rat pricing
NM_145629 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057013 predicted 223
2 SASI_Hs01_00057014 predicted 1563
3 SASI_Hs01_00057015 predicted 1468
4 SASI_Hs01_00057017 predicted 500
5 SASI_Hs01_00057019 predicted 1695
6 SASI_Hs01_00057020 predicted 1297
7 SASI_Hs01_00057021 predicted 857
8 SASI_Hs01_00057022 predicted 1371
9 SASI_Hs02_00338817 predicted 801
10 SASI_Hs02_00338818 predicted 1315
11 SASI_Hs01_00057016 predicted 1638
12 SASI_Hs01_00057018 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057425 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286289 predicted 1130
2 SASI_Rn02_00286290 predicted 1701
3 SASI_Rn02_00286291 predicted 571
4 SASI_Rn02_00286292 predicted 2044
5 SASI_Rn02_00286293 predicted 1147
6 SASI_Rn02_00286294 predicted 2123
7 SASI_Rn02_00286295 predicted 2070
8 SASI_Rn02_00286296 predicted 1665
9 SASI_Rn02_00286297 predicted 657
10 SASI_Rn02_00286298 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286716 predicted 1112
2 SASI_Rn02_00286717 predicted 1691
3 SASI_Rn02_00286718 predicted 587
4 SASI_Rn02_00286719 predicted 2035
5 SASI_Rn02_00286720 predicted 1134
6 SASI_Rn02_00286721 predicted 2112
7 SASI_Rn02_00286722 predicted 2054
8 SASI_Rn02_00286723 predicted 1639
9 SASI_Rn02_00286724 predicted 668
10 SASI_Rn02_00286725 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396289 predicted 1655
2 SASI_Rn02_00396290 predicted 572
3 SASI_Rn02_00396291 predicted 1994
4 SASI_Rn02_00396292 predicted 1096
5 SASI_Rn02_00396293 predicted 2073
6 SASI_Rn02_00396294 predicted 2018
7 SASI_Rn02_00396295 predicted 1608
8 SASI_Rn02_00396296 predicted 654
9 SASI_Rn02_00396297 predicted 503
10 SASI_Rn02_00396298 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165794 predicted 1884
2 SASI_Mm01_00165795 predicted 1194
3 SASI_Mm02_00341212 predicted 2173
4 SASI_Mm01_00165796 predicted 412
5 SASI_Mm01_00165798 predicted 624
6 SASI_Mm01_00165799 predicted 1566
7 SASI_Mm01_00165800 predicted 452
8 SASI_Mm01_00165801 predicted 1286
9 SASI_Mm01_00165802 predicted 2100
10 SASI_Mm01_00165803 predicted 2143
11 SASI_Mm01_00165797 predicted 2189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145629
VALIDATED
PLS3 MISSION shRNA Bacterial Glycerol Stock
plastin 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145629.1-352s1c1
Sequence:CCGGCCGGATATAAAGTGAGAGAAACTCGAGTTTCTCTCACTTTATATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145629.1-353s1c1
Sequence:CCGGCGGATATAAAGTGAGAGAAATCTCGAGATTTCTCTCACTTTATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145629.1-1121s1c1
Sequence:CCGGGCTCAATCAAATCGCACCGAACTCGAGTTCGGTGCGATTTGATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145629.1-1215s1c1
Sequence:CCGGGCCGAAAGTATGCTTCAACAACTCGAGTTGTTGAAGCATACTTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145629.1-2958s1c1
Sequence:CCGGGCTCAGAATTTAGACGGGAATCTCGAGATTCCCGTCTAAATTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145629.1-353s21c1
Sequence:CCGGCGGATATAAAGTGAGAGAAATCTCGAGATTTCTCTCACTTTATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145629.1-1121s21c1
Sequence:CCGGGCTCAATCAAATCGCACCGAACTCGAGTTCGGTGCGATTTGATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145629.1-1215s21c1
Sequence:CCGGGCCGAAAGTATGCTTCAACAACTCGAGTTGTTGAAGCATACTTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145629.1-2958s21c1
Sequence:CCGGGCTCAGAATTTAGACGGGAATCTCGAGATTCCCGTCTAAATTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145629
VALIDATED
PLS3 MISSION shRNA shRNA Plasmid DNA
plastin 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145629.1-352s1c1
Sequence:CCGGCCGGATATAAAGTGAGAGAAACTCGAGTTTCTCTCACTTTATATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145629.1-353s1c1
Sequence:CCGGCGGATATAAAGTGAGAGAAATCTCGAGATTTCTCTCACTTTATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145629.1-1121s1c1
Sequence:CCGGGCTCAATCAAATCGCACCGAACTCGAGTTCGGTGCGATTTGATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145629.1-1215s1c1
Sequence:CCGGGCCGAAAGTATGCTTCAACAACTCGAGTTGTTGAAGCATACTTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145629.1-2958s1c1
Sequence:CCGGGCTCAGAATTTAGACGGGAATCTCGAGATTCCCGTCTAAATTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145629.1-353s21c1
Sequence:CCGGCGGATATAAAGTGAGAGAAATCTCGAGATTTCTCTCACTTTATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145629.1-1121s21c1
Sequence:CCGGGCTCAATCAAATCGCACCGAACTCGAGTTCGGTGCGATTTGATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145629.1-1215s21c1
Sequence:CCGGGCCGAAAGTATGCTTCAACAACTCGAGTTGTTGAAGCATACTTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145629.1-2958s21c1
Sequence:CCGGGCTCAGAATTTAGACGGGAATCTCGAGATTCCCGTCTAAATTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145629
VALIDATED
PLS3 MISSION shRNA Lentiviral Transduction Particles
plastin 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145629.1-352s1c1
Sequence:CCGGCCGGATATAAAGTGAGAGAAACTCGAGTTTCTCTCACTTTATATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145629.1-353s1c1
Sequence:CCGGCGGATATAAAGTGAGAGAAATCTCGAGATTTCTCTCACTTTATATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145629.1-1121s1c1
Sequence:CCGGGCTCAATCAAATCGCACCGAACTCGAGTTCGGTGCGATTTGATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145629.1-1215s1c1
Sequence:CCGGGCCGAAAGTATGCTTCAACAACTCGAGTTGTTGAAGCATACTTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145629.1-2958s1c1
Sequence:CCGGGCTCAGAATTTAGACGGGAATCTCGAGATTCCCGTCTAAATTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145629.1-353s21c1
Sequence:CCGGCGGATATAAAGTGAGAGAAATCTCGAGATTTCTCTCACTTTATATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145629.1-1121s21c1
Sequence:CCGGGCTCAATCAAATCGCACCGAACTCGAGTTCGGTGCGATTTGATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145629.1-1215s21c1
Sequence:CCGGGCCGAAAGTATGCTTCAACAACTCGAGTTGTTGAAGCATACTTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145629.1-2958s21c1
Sequence:CCGGGCTCAGAATTTAGACGGGAATCTCGAGATTCCCGTCTAAATTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005032
VALIDATED
PLS3 MISSION shRNA Bacterial Glycerol Stock
plastin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005032.3-2849s1c1
Sequence:CCGGGCTCAGAACTTAGACGGGATTCTCGAGAATCCCGTCTAAGTTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005032.3-967s1c1
Sequence:CCGGGCTGACATCAAGGATTCCAAACTCGAGTTTGGAATCCTTGATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005032.3-1363s1c1
Sequence:CCGGGCCCTGGTAATCTTACAGTTACTCGAGTAACTGTAAGATTACCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005032.3-783s1c1
Sequence:CCGGGCAGATCATTAAGATCGGTTTCTCGAGAAACCGATCTTAATGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005032.3-1096s1c1
Sequence:CCGGGCTGAGAGTATGCTTCAACAACTCGAGTTGTTGAAGCATACTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005032
VALIDATED
PLS3 MISSION shRNA shRNA Plasmid DNA
plastin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005032.3-2849s1c1
Sequence:CCGGGCTCAGAACTTAGACGGGATTCTCGAGAATCCCGTCTAAGTTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005032.3-967s1c1
Sequence:CCGGGCTGACATCAAGGATTCCAAACTCGAGTTTGGAATCCTTGATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005032.3-1363s1c1
Sequence:CCGGGCCCTGGTAATCTTACAGTTACTCGAGTAACTGTAAGATTACCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005032.3-783s1c1
Sequence:CCGGGCAGATCATTAAGATCGGTTTCTCGAGAAACCGATCTTAATGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005032.3-1096s1c1
Sequence:CCGGGCTGAGAGTATGCTTCAACAACTCGAGTTGTTGAAGCATACTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005032
VALIDATED
PLS3 MISSION shRNA Lentiviral Transduction Particles
plastin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005032.3-2849s1c1
Sequence:CCGGGCTCAGAACTTAGACGGGATTCTCGAGAATCCCGTCTAAGTTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005032.3-967s1c1
Sequence:CCGGGCTGACATCAAGGATTCCAAACTCGAGTTTGGAATCCTTGATGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005032.3-1363s1c1
Sequence:CCGGGCCCTGGTAATCTTACAGTTACTCGAGTAACTGTAAGATTACCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005032.3-783s1c1
Sequence:CCGGGCAGATCATTAAGATCGGTTTCTCGAGAAACCGATCTTAATGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005032.3-1096s1c1
Sequence:CCGGGCTGAGAGTATGCTTCAACAACTCGAGTTGTTGAAGCATACTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)