EMAIL THIS PAGE TO A FRIEND

PLSCR3

phospholipid scramblase 3

100 Gene Product Result for
UniProtKB ID: Q9NRY6, A8K252, Q567U0, Q8NBW6, Q96F13
Gene ID:
Mouse(70310) phospholipid scramblase 3
Rat(360549) phospholipid scramblase 3
domestic cat(101096426) phospholipid scramblase 3
dog(489471) phospholipid scramblase 3
cow(510355) phospholipid scramblase 3
sheep(101120094) phospholipid scramblase 3
domestic guinea pig(100735353) phospholipid scramblase 3
naked mole-rat(101719533) phospholipid scramblase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020360 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020360 Rosetta Predictions human pricing
NM_001012139 Rosetta Predictions rat pricing
XM_573126 Rosetta Predictions rat pricing
NM_023564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171610 predicted 938
2 SASI_Hs01_00171611 predicted 740
3 SASI_Hs01_00171612 predicted 1457
4 SASI_Hs01_00171613 predicted 1016
5 SASI_Hs01_00171614 predicted 868
6 SASI_Hs01_00171615 predicted 1115
7 SASI_Hs01_00171617 predicted 858
8 SASI_Hs02_00353296 predicted 1127
9 SASI_Hs02_00353297 predicted 1032
10 SASI_Hs02_00353298 predicted 739
11 SASI_Hs01_00171609 predicted 1507
12 SASI_Hs01_00171616 predicted 964
13 SASI_Hs01_00171618 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200307 predicted 1040
2 SASI_Rn01_00071155 predicted 1304
3 SASI_Rn01_00071156 predicted 1340
4 SASI_Rn02_00200308 predicted 893
5 SASI_Rn02_00200309 predicted 758
6 SASI_Rn01_00071159 predicted 1132
7 SASI_Rn01_00071160 predicted 1426
8 SASI_Rn01_00071163 predicted 526
9 SASI_Rn02_00200310 predicted 1505
10 SASI_Rn02_00200311 predicted 1219
11 SASI_Rn01_00071154 predicted 1192
12 SASI_Rn01_00071157 predicted 717
13 SASI_Rn01_00071158 predicted 1524
14 SASI_Rn01_00071161 predicted 570
15 SASI_Rn01_00071162 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191916 predicted 706
2 SASI_Rn01_00191917 predicted 714
3 SASI_Rn01_00191918 predicted 442
4 SASI_Rn01_00191919 predicted 455
5 SASI_Rn01_00191920 predicted 573
6 SASI_Rn01_00191921 predicted 534
7 SASI_Rn01_00191922 predicted 535
8 SASI_Rn01_00191923 predicted 481
9 SASI_Rn01_00191924 predicted 470
10 SASI_Rn01_00191925 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156486 predicted 1141
2 SASI_Mm01_00156487 predicted 1226
3 SASI_Mm02_00327190 predicted 1338
4 SASI_Mm01_00156488 predicted 734
5 SASI_Mm01_00156489 predicted 1684
6 SASI_Mm01_00156491 predicted 1067
7 SASI_Mm01_00156492 predicted 614
8 SASI_Mm01_00156493 predicted 1021
9 SASI_Mm01_00156494 predicted 1118
10 SASI_Mm01_00156495 predicted 1595
11 SASI_Mm01_00156490 predicted 931
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023564
PLSCR3 MISSION shRNA Bacterial Glycerol Stock
phospholipid scramblase 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023564.3-1226s21c1
Sequence:CCGGCGATTATATGTTCTTCGAGAACTCGAGTTCTCGAAGAACATATAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023564.3-1170s21c1
Sequence:CCGGCCAGTCGATCTAGATGTGAAACTCGAGTTTCACATCTAGATCGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023564.3-629s21c1
Sequence:CCGGCCTAGTGCAGATTGATCAAATCTCGAGATTTGATCAATCTGCACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023564.2-1989s1c1
Sequence:CCGGGCCTGTATAATCTACACTATTCTCGAGAATAGTGTAGATTATACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023564.2-1170s1c1
Sequence:CCGGCCAGTCGATCTAGATGTGAAACTCGAGTTTCACATCTAGATCGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023564.2-629s1c1
Sequence:CCGGCCTAGTGCAGATTGATCAAATCTCGAGATTTGATCAATCTGCACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023564.2-999s1c1
Sequence:CCGGCAACCTGTTCTACGAGTTGTACTCGAGTACAACTCGTAGAACAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023564.2-1226s1c1
Sequence:CCGGCGATTATATGTTCTTCGAGAACTCGAGTTCTCGAAGAACATATAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023564.3-999s21c1
Sequence:CCGGCAACCTGTTCTACGAGTTGTACTCGAGTACAACTCGTAGAACAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023564
PLSCR3 MISSION shRNA shRNA Plasmid DNA
phospholipid scramblase 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023564.3-1226s21c1
Sequence:CCGGCGATTATATGTTCTTCGAGAACTCGAGTTCTCGAAGAACATATAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023564.3-1170s21c1
Sequence:CCGGCCAGTCGATCTAGATGTGAAACTCGAGTTTCACATCTAGATCGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023564.3-629s21c1
Sequence:CCGGCCTAGTGCAGATTGATCAAATCTCGAGATTTGATCAATCTGCACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023564.2-1989s1c1
Sequence:CCGGGCCTGTATAATCTACACTATTCTCGAGAATAGTGTAGATTATACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023564.2-1170s1c1
Sequence:CCGGCCAGTCGATCTAGATGTGAAACTCGAGTTTCACATCTAGATCGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023564.2-629s1c1
Sequence:CCGGCCTAGTGCAGATTGATCAAATCTCGAGATTTGATCAATCTGCACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023564.2-999s1c1
Sequence:CCGGCAACCTGTTCTACGAGTTGTACTCGAGTACAACTCGTAGAACAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023564.2-1226s1c1
Sequence:CCGGCGATTATATGTTCTTCGAGAACTCGAGTTCTCGAAGAACATATAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023564.3-999s21c1
Sequence:CCGGCAACCTGTTCTACGAGTTGTACTCGAGTACAACTCGTAGAACAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023564
PLSCR3 MISSION shRNA Lentiviral Transduction Particles
phospholipid scramblase 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023564.3-1226s21c1
Sequence:CCGGCGATTATATGTTCTTCGAGAACTCGAGTTCTCGAAGAACATATAATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023564.3-1170s21c1
Sequence:CCGGCCAGTCGATCTAGATGTGAAACTCGAGTTTCACATCTAGATCGACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023564.3-629s21c1
Sequence:CCGGCCTAGTGCAGATTGATCAAATCTCGAGATTTGATCAATCTGCACTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023564.2-1989s1c1
Sequence:CCGGGCCTGTATAATCTACACTATTCTCGAGAATAGTGTAGATTATACAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023564.2-1170s1c1
Sequence:CCGGCCAGTCGATCTAGATGTGAAACTCGAGTTTCACATCTAGATCGACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023564.2-629s1c1
Sequence:CCGGCCTAGTGCAGATTGATCAAATCTCGAGATTTGATCAATCTGCACTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023564.2-999s1c1
Sequence:CCGGCAACCTGTTCTACGAGTTGTACTCGAGTACAACTCGTAGAACAGGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023564.2-1226s1c1
Sequence:CCGGCGATTATATGTTCTTCGAGAACTCGAGTTCTCGAAGAACATATAATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023564.3-999s21c1
Sequence:CCGGCAACCTGTTCTACGAGTTGTACTCGAGTACAACTCGTAGAACAGGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020360
VALIDATED
PLSCR3 MISSION shRNA Bacterial Glycerol Stock
phospholipid scramblase 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_020360.2-877s21c1
Sequence:CCGGAGGTGAAGACTCGGGATGAATCTCGAGATTCATCCCGAGTCTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020360.2-1028s21c1
Sequence:CCGGCACATTCCTCATTGACTACATCTCGAGATGTAGTCAATGAGGAATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020360.2-443s1c1
Sequence:CCGGCCTGGTGCAGATTGATCAGATCTCGAGATCTGATCAATCTGCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020360.2-877s1c1
Sequence:CCGGAGGTGAAGACTCGGGATGAATCTCGAGATTCATCCCGAGTCTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020360.2-1028s1c1
Sequence:CCGGCACATTCCTCATTGACTACATCTCGAGATGTAGTCAATGAGGAATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_020360.2-1464s21c1
Sequence:CCGGGCACCAAAGACGGTGGATATACTCGAGTATATCCACCGTCTTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020360.2-510s1c1
Sequence:CCGGGAGACCTGTAATCGGTATGAACTCGAGTTCATACCGATTACAGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_020360.2-758s1c1
Sequence:CCGGGCTACAGACCTGGCATCCCTTCTCGAGAAGGGATGCCAGGTCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020360.2-484s21c1
Sequence:CCGGAGCGAGTGGAAACGTTCCTAGCTCGAGCTAGGAACGTTTCCACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020360
VALIDATED
PLSCR3 MISSION shRNA shRNA Plasmid DNA
phospholipid scramblase 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_020360.2-877s21c1
Sequence:CCGGAGGTGAAGACTCGGGATGAATCTCGAGATTCATCCCGAGTCTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020360.2-1028s21c1
Sequence:CCGGCACATTCCTCATTGACTACATCTCGAGATGTAGTCAATGAGGAATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020360.2-443s1c1
Sequence:CCGGCCTGGTGCAGATTGATCAGATCTCGAGATCTGATCAATCTGCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020360.2-877s1c1
Sequence:CCGGAGGTGAAGACTCGGGATGAATCTCGAGATTCATCCCGAGTCTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020360.2-1028s1c1
Sequence:CCGGCACATTCCTCATTGACTACATCTCGAGATGTAGTCAATGAGGAATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_020360.2-1464s21c1
Sequence:CCGGGCACCAAAGACGGTGGATATACTCGAGTATATCCACCGTCTTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020360.2-510s1c1
Sequence:CCGGGAGACCTGTAATCGGTATGAACTCGAGTTCATACCGATTACAGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_020360.2-758s1c1
Sequence:CCGGGCTACAGACCTGGCATCCCTTCTCGAGAAGGGATGCCAGGTCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020360.2-484s21c1
Sequence:CCGGAGCGAGTGGAAACGTTCCTAGCTCGAGCTAGGAACGTTTCCACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020360
VALIDATED
PLSCR3 MISSION shRNA Lentiviral Transduction Particles
phospholipid scramblase 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_020360.2-877s21c1
Sequence:CCGGAGGTGAAGACTCGGGATGAATCTCGAGATTCATCCCGAGTCTTCACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020360.2-1028s21c1
Sequence:CCGGCACATTCCTCATTGACTACATCTCGAGATGTAGTCAATGAGGAATGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020360.2-443s1c1
Sequence:CCGGCCTGGTGCAGATTGATCAGATCTCGAGATCTGATCAATCTGCACCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020360.2-877s1c1
Sequence:CCGGAGGTGAAGACTCGGGATGAATCTCGAGATTCATCCCGAGTCTTCACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020360.2-1028s1c1
Sequence:CCGGCACATTCCTCATTGACTACATCTCGAGATGTAGTCAATGAGGAATGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_020360.2-1464s21c1
Sequence:CCGGGCACCAAAGACGGTGGATATACTCGAGTATATCCACCGTCTTTGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020360.2-510s1c1
Sequence:CCGGGAGACCTGTAATCGGTATGAACTCGAGTTCATACCGATTACAGGTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_020360.2-758s1c1
Sequence:CCGGGCTACAGACCTGGCATCCCTTCTCGAGAAGGGATGCCAGGTCTGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020360.2-484s21c1
Sequence:CCGGAGCGAGTGGAAACGTTCCTAGCTCGAGCTAGGAACGTTTCCACTCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)