EMAIL THIS PAGE TO A FRIEND

PLTP

phospholipid transfer protein

72 Gene Product Result for
Synonyms: BPIFE HDLCQ9
Gene ID:
Human(5360) Summary: The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18830) phospholipid transfer protein
Rat(296371) phospholipid transfer protein
cow(505640) phospholipid transfer protein
sheep(101115982) phospholipid transfer protein
domestic guinea pig(100720780) phospholipid transfer protein
naked mole-rat(101721295) phospholipid transfer protein
Domestic Rabbit(100008882) phospholipid transfer protein
Zebrafish(445125) phospholipid transfer protein
Horse(100056507) phospholipid transfer protein
domestic cat(101084950) phospholipid transfer protein
dog(485903) phospholipid transfer protein
chicken(428164) phospholipid transfer protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK108 PLTP Activity Assay Kit Supplied by Roar Biomedical, Inc. human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006227 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011125 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011125 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011125 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU094351 MISSION® esiRNA esiRNA targeting mouse Pltp (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006227 Rosetta Predictions human pricing
NM_182676 Rosetta Predictions human pricing
XM_001072197 Rosetta Predictions rat pricing
XM_215939 Rosetta Predictions rat pricing
NM_011125 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043199 predicted 985
2 SASI_Hs01_00043201 predicted 1400
3 SASI_Hs01_00043202 predicted 847
4 SASI_Hs01_00043203 predicted 1253
5 SASI_Hs01_00043204 predicted 1390
6 SASI_Hs02_00341143 predicted 982
7 SASI_Hs01_00043205 predicted 1449
8 SASI_Hs01_00043206 predicted 1268
9 SASI_Hs01_00043207 predicted 1428
10 SASI_Hs01_00043208 predicted 1497
11 SASI_Hs01_00043200 predicted 1322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135784 predicted 831
2 SASI_Hs01_00135786 predicted 1240
3 SASI_Hs01_00135787 predicted 695
4 SASI_Hs01_00135788 predicted 1101
5 SASI_Hs01_00135789 predicted 1234
6 SASI_Hs02_00370844 predicted 819
7 SASI_Hs01_00135790 predicted 1294
8 SASI_Hs01_00135791 predicted 1107
9 SASI_Hs01_00135792 predicted 1270
10 SASI_Hs01_00135793 predicted 1341
11 SASI_Hs01_00135785 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338171 predicted 458
2 SASI_Rn02_00338172 predicted 469
3 SASI_Rn02_00338173 predicted 978
4 SASI_Rn02_00338174 predicted 902
5 SASI_Rn02_00338175 predicted 717
6 SASI_Rn02_00338176 predicted 470
7 SASI_Rn02_00338177 predicted 1185
8 SASI_Rn02_00338178 predicted 573
9 SASI_Rn02_00338179 predicted 284
10 SASI_Rn02_00338180 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215939 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376304 predicted 1422
2 SASI_Rn02_00376305 predicted 934
3 SASI_Rn02_00376306 predicted 1467
4 SASI_Rn02_00376307 predicted 1566
5 SASI_Rn02_00376308 predicted 712
6 SASI_Rn02_00376309 predicted 1189
7 SASI_Rn02_00376310 predicted 1289
8 SASI_Rn02_00376311 predicted 565
9 SASI_Rn02_00376312 predicted 283
10 SASI_Rn02_00376313 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091424 predicted 1071
2 SASI_Mm01_00091425 predicted 396
3 SASI_Mm02_00319943 predicted 1020
4 SASI_Mm01_00091426 predicted 1299
5 SASI_Mm01_00091427 predicted 224
6 SASI_Mm01_00091428 predicted 662
7 SASI_Mm01_00091429 predicted 542
8 SASI_Mm01_00091430 predicted 1335
9 SASI_Mm01_00091431 predicted 747
10 SASI_Mm01_00091432 predicted 1070
11 SASI_Mm01_00091433 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006227
PLTP MISSION shRNA Bacterial Glycerol Stock
phospholipid transfer protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006227.2-1290s21c1
Sequence:CCGGTCGCTGGCTCTGATCCCATTACTCGAGTAATGGGATCAGAGCCAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006227.2-1393s21c1
Sequence:CCGGTACCTGAGGGCATCAACTTTGCTCGAGCAAAGTTGATGCCCTCAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006227.2-305s21c1
Sequence:CCGGGACATCTTCCGAGCTCGATTTCTCGAGAAATCGAGCTCGGAAGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-342s1c1
Sequence:CCGGCTGATGCTTCAAATCACCAATCTCGAGATTGGTGATTTGAAGCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-722s1c1
Sequence:CCGGCATTGACTATTCCCTCATGAACTCGAGTTCATGAGGGAATAGTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006227.2-711s1c1
Sequence:CCGGGAGCTTGTTGGCATTGACTATCTCGAGATAGTCAATGCCAACAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-1260s1c1
Sequence:CCGGCGAATCTATTCCAACCATTCTCTCGAGAGAATGGTTGGAATAGATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-1253s1c1
Sequence:CCGGCAGGTTCCGAATCTATTCCAACTCGAGTTGGAATAGATTCGGAACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006227.2-393s1c1
Sequence:CCGGCTGCTCTACTGGTTCTTCTATCTCGAGATAGAAGAACCAGTAGAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-721s1c1
Sequence:CCGGGCATTGACTATTCCCTCATGACTCGAGTCATGAGGGAATAGTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006227
PLTP MISSION shRNA shRNA Plasmid DNA
phospholipid transfer protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006227.2-1290s21c1
Sequence:CCGGTCGCTGGCTCTGATCCCATTACTCGAGTAATGGGATCAGAGCCAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006227.2-1393s21c1
Sequence:CCGGTACCTGAGGGCATCAACTTTGCTCGAGCAAAGTTGATGCCCTCAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006227.2-305s21c1
Sequence:CCGGGACATCTTCCGAGCTCGATTTCTCGAGAAATCGAGCTCGGAAGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-342s1c1
Sequence:CCGGCTGATGCTTCAAATCACCAATCTCGAGATTGGTGATTTGAAGCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-722s1c1
Sequence:CCGGCATTGACTATTCCCTCATGAACTCGAGTTCATGAGGGAATAGTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006227.2-711s1c1
Sequence:CCGGGAGCTTGTTGGCATTGACTATCTCGAGATAGTCAATGCCAACAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-1260s1c1
Sequence:CCGGCGAATCTATTCCAACCATTCTCTCGAGAGAATGGTTGGAATAGATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-1253s1c1
Sequence:CCGGCAGGTTCCGAATCTATTCCAACTCGAGTTGGAATAGATTCGGAACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006227.2-393s1c1
Sequence:CCGGCTGCTCTACTGGTTCTTCTATCTCGAGATAGAAGAACCAGTAGAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-721s1c1
Sequence:CCGGGCATTGACTATTCCCTCATGACTCGAGTCATGAGGGAATAGTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006227
PLTP MISSION shRNA Lentiviral Transduction Particles
phospholipid transfer protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006227.2-1290s21c1
Sequence:CCGGTCGCTGGCTCTGATCCCATTACTCGAGTAATGGGATCAGAGCCAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006227.2-1393s21c1
Sequence:CCGGTACCTGAGGGCATCAACTTTGCTCGAGCAAAGTTGATGCCCTCAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006227.2-305s21c1
Sequence:CCGGGACATCTTCCGAGCTCGATTTCTCGAGAAATCGAGCTCGGAAGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-342s1c1
Sequence:CCGGCTGATGCTTCAAATCACCAATCTCGAGATTGGTGATTTGAAGCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-722s1c1
Sequence:CCGGCATTGACTATTCCCTCATGAACTCGAGTTCATGAGGGAATAGTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006227.2-711s1c1
Sequence:CCGGGAGCTTGTTGGCATTGACTATCTCGAGATAGTCAATGCCAACAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-1260s1c1
Sequence:CCGGCGAATCTATTCCAACCATTCTCTCGAGAGAATGGTTGGAATAGATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-1253s1c1
Sequence:CCGGCAGGTTCCGAATCTATTCCAACTCGAGTTGGAATAGATTCGGAACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006227.2-393s1c1
Sequence:CCGGCTGCTCTACTGGTTCTTCTATCTCGAGATAGAAGAACCAGTAGAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006227.2-721s1c1
Sequence:CCGGGCATTGACTATTCCCTCATGACTCGAGTCATGAGGGAATAGTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011125
VALIDATED
PLTP MISSION shRNA Bacterial Glycerol Stock
phospholipid transfer protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011125.2-1644s21c1
Sequence:CCGGGCATTCAGGAACCTAACTGAACTCGAGTTCAGTTAGGTTCCTGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011125.2-766s21c1
Sequence:CCGGTGATCTCGTGGGCATCGATTACTCGAGTAATCGATGCCCACGAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011125.2-572s21c1
Sequence:CCGGTGCGAGGCCTCTGTGTCTAAACTCGAGTTTAGACACAGAGGCCTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011125.2-445s21c1
Sequence:CCGGGCAGCTACTCTACTGGTTCTTCTCGAGAAGAACCAGTAGAGTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011125.2-536s21c1
Sequence:CCGGGATTCCAGTGGTCGGATTAAACTCGAGTTTAATCCGACCACTGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011125.1-1574s1c1
Sequence:CCGGGCATTCAGGAACCTAACTGAACTCGAGTTCAGTTAGGTTCCTGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011125.1-375s1c1
Sequence:CCGGGCAGCTACTCTACTGGTTCTTCTCGAGAAGAACCAGTAGAGTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011125.1-979s1c1
Sequence:CCGGGCCACCTACTTTGGGAGCATTCTCGAGAATGCTCCCAAAGTAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011125.1-376s1c1
Sequence:CCGGCAGCTACTCTACTGGTTCTTACTCGAGTAAGAACCAGTAGAGTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011125
VALIDATED
PLTP MISSION shRNA shRNA Plasmid DNA
phospholipid transfer protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011125.2-1644s21c1
Sequence:CCGGGCATTCAGGAACCTAACTGAACTCGAGTTCAGTTAGGTTCCTGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011125.2-766s21c1
Sequence:CCGGTGATCTCGTGGGCATCGATTACTCGAGTAATCGATGCCCACGAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011125.2-572s21c1
Sequence:CCGGTGCGAGGCCTCTGTGTCTAAACTCGAGTTTAGACACAGAGGCCTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011125.2-445s21c1
Sequence:CCGGGCAGCTACTCTACTGGTTCTTCTCGAGAAGAACCAGTAGAGTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011125.2-536s21c1
Sequence:CCGGGATTCCAGTGGTCGGATTAAACTCGAGTTTAATCCGACCACTGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011125.1-1574s1c1
Sequence:CCGGGCATTCAGGAACCTAACTGAACTCGAGTTCAGTTAGGTTCCTGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011125.1-375s1c1
Sequence:CCGGGCAGCTACTCTACTGGTTCTTCTCGAGAAGAACCAGTAGAGTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011125.1-979s1c1
Sequence:CCGGGCCACCTACTTTGGGAGCATTCTCGAGAATGCTCCCAAAGTAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011125.1-376s1c1
Sequence:CCGGCAGCTACTCTACTGGTTCTTACTCGAGTAAGAACCAGTAGAGTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011125
VALIDATED
PLTP MISSION shRNA Lentiviral Transduction Particles
phospholipid transfer protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011125.2-1644s21c1
Sequence:CCGGGCATTCAGGAACCTAACTGAACTCGAGTTCAGTTAGGTTCCTGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011125.2-766s21c1
Sequence:CCGGTGATCTCGTGGGCATCGATTACTCGAGTAATCGATGCCCACGAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011125.2-572s21c1
Sequence:CCGGTGCGAGGCCTCTGTGTCTAAACTCGAGTTTAGACACAGAGGCCTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011125.2-445s21c1
Sequence:CCGGGCAGCTACTCTACTGGTTCTTCTCGAGAAGAACCAGTAGAGTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011125.2-536s21c1
Sequence:CCGGGATTCCAGTGGTCGGATTAAACTCGAGTTTAATCCGACCACTGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011125.1-1574s1c1
Sequence:CCGGGCATTCAGGAACCTAACTGAACTCGAGTTCAGTTAGGTTCCTGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011125.1-375s1c1
Sequence:CCGGGCAGCTACTCTACTGGTTCTTCTCGAGAAGAACCAGTAGAGTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011125.1-979s1c1
Sequence:CCGGGCCACCTACTTTGGGAGCATTCTCGAGAATGCTCCCAAAGTAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011125.1-376s1c1
Sequence:CCGGCAGCTACTCTACTGGTTCTTACTCGAGTAAGAACCAGTAGAGTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)