EMAIL THIS PAGE TO A FRIEND

PLVAP

plasmalemma vesicle associated protein

46 Gene Product Result for
Synonyms: FELS PV-1 PV1 gp68
UniProtKB ID: Q9BX97, Q86VP0, Q8N8Y0, Q8ND68, Q8TER8, Q9BZD5
Gene ID:
Mouse(84094) plasmalemma vesicle associated protein
Rat(56765) plasmalemma vesicle associated protein
chicken(100857417) plasmalemma vesicle associated protein
domestic cat(101083067) plasmalemma vesicle associated protein
dog(484837) plasmalemma vesicle associated protein
cow(524990) plasmalemma vesicle associated protein
sheep(101111878) plasmalemma vesicle associated protein
naked mole-rat(101717333) plasmalemma vesicle associated protein
domestic guinea pig(100733857) plasmalemma vesicle associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031310 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031310 Rosetta Predictions human pricing
NM_020086 Rosetta Predictions rat pricing
NM_032398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146356 predicted 325
2 SASI_Hs01_00146358 predicted 1173
3 SASI_Hs01_00146359 predicted 1313
4 SASI_Hs01_00146360 predicted 512
5 SASI_Hs01_00146361 predicted 1412
6 SASI_Hs01_00146362 predicted 456
7 SASI_Hs01_00146363 predicted 449
8 SASI_Hs01_00146364 predicted 765
9 SASI_Hs01_00146365 predicted 573
10 SASI_Hs02_00358757 predicted 1205
11 SASI_Hs01_00146357 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055540 predicted 414
2 SASI_Rn01_00055541 predicted 753
3 SASI_Rn01_00055542 predicted 750
4 SASI_Rn01_00055543 predicted 408
5 SASI_Rn01_00055544 predicted 1567
6 SASI_Rn01_00055545 predicted 1335
7 SASI_Rn01_00055546 predicted 1579
8 SASI_Rn01_00055547 predicted 1691
9 SASI_Rn01_00055549 predicted 206
10 SASI_Rn02_00262493 predicted 420
11 SASI_Rn01_00055548 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092861 predicted 333
2 SASI_Mm01_00092862 predicted 416
3 SASI_Mm01_00092863 predicted 406
4 SASI_Mm01_00092864 predicted 614
5 SASI_Mm01_00092865 predicted 1695
6 SASI_Mm01_00092866 predicted 1631
7 SASI_Mm01_00092867 predicted 1523
8 SASI_Mm01_00092868 predicted 1368
9 SASI_Mm01_00092869 predicted 459
10 SASI_Mm01_00092870 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032398
PLVAP MISSION shRNA Bacterial Glycerol Stock
plasmalemma vesicle associated protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032398.1-1728s1c1
Sequence:CCGGCTAGGGTTTCCAGATCCTATTCTCGAGAATAGGATCTGGAAACCCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032398.1-149s21c1
Sequence:CCGGTGGTCCTCTTCATGATCTATGCTCGAGCATAGATCATGAAGAGGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032398.1-390s1c1
Sequence:CCGGGATCACCTACATAAACTATAACTCGAGTTATAGTTTATGTAGGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032398.1-107s21c1
Sequence:CCGGTCCTCTTCGTGTCGCTCATTCCTCGAGGAATGAGCGACACGAAGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032398.1-1730s21c1
Sequence:CCGGAGGGTTTCCAGATCCTATTTGCTCGAGCAAATAGGATCTGGAAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032398.1-389s21c1
Sequence:CCGGTGATCACCTACATAAACTATACTCGAGTATAGTTTATGTAGGTGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032398.1-85s21c1
Sequence:CCGGTGGTACTACCTGCGCTATTTCCTCGAGGAAATAGCGCAGGTAGTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032398
PLVAP MISSION shRNA shRNA Plasmid DNA
plasmalemma vesicle associated protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032398.1-1728s1c1
Sequence:CCGGCTAGGGTTTCCAGATCCTATTCTCGAGAATAGGATCTGGAAACCCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032398.1-149s21c1
Sequence:CCGGTGGTCCTCTTCATGATCTATGCTCGAGCATAGATCATGAAGAGGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032398.1-390s1c1
Sequence:CCGGGATCACCTACATAAACTATAACTCGAGTTATAGTTTATGTAGGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032398.1-107s21c1
Sequence:CCGGTCCTCTTCGTGTCGCTCATTCCTCGAGGAATGAGCGACACGAAGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032398.1-1730s21c1
Sequence:CCGGAGGGTTTCCAGATCCTATTTGCTCGAGCAAATAGGATCTGGAAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032398.1-389s21c1
Sequence:CCGGTGATCACCTACATAAACTATACTCGAGTATAGTTTATGTAGGTGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032398.1-85s21c1
Sequence:CCGGTGGTACTACCTGCGCTATTTCCTCGAGGAAATAGCGCAGGTAGTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032398
PLVAP MISSION shRNA Lentiviral Transduction Particles
plasmalemma vesicle associated protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032398.1-1728s1c1
Sequence:CCGGCTAGGGTTTCCAGATCCTATTCTCGAGAATAGGATCTGGAAACCCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032398.1-149s21c1
Sequence:CCGGTGGTCCTCTTCATGATCTATGCTCGAGCATAGATCATGAAGAGGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032398.1-390s1c1
Sequence:CCGGGATCACCTACATAAACTATAACTCGAGTTATAGTTTATGTAGGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032398.1-107s21c1
Sequence:CCGGTCCTCTTCGTGTCGCTCATTCCTCGAGGAATGAGCGACACGAAGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032398.1-1730s21c1
Sequence:CCGGAGGGTTTCCAGATCCTATTTGCTCGAGCAAATAGGATCTGGAAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032398.1-389s21c1
Sequence:CCGGTGATCACCTACATAAACTATACTCGAGTATAGTTTATGTAGGTGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032398.1-85s21c1
Sequence:CCGGTGGTACTACCTGCGCTATTTCCTCGAGGAAATAGCGCAGGTAGTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031310
PLVAP MISSION shRNA Bacterial Glycerol Stock
plasmalemma vesicle associated protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031310.1-578s1c1
Sequence:CCGGGACCATTTGCACTAAGGATAACTCGAGTTATCCTTAGTGCAAATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031310.1-521s1c1
Sequence:CCGGGCTCTTCATGCTGAATCAGAACTCGAGTTCTGATTCAGCATGAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149971    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031310.1-1922s1c1
Sequence:CCGGCACACACACTTTCTACCCAATCTCGAGATTGGGTAGAAAGTGTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031310.1-425s1c1
Sequence:CCGGCTACACGAACAATCAGAGGTACTCGAGTACCTCTGATTGTTCGTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031310.1-495s1c1
Sequence:CCGGGACATGAACAAGAGCTGCGATCTCGAGATCGCAGCTCTTGTTCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031310.1-113s1c1
Sequence:CCGGCTGGTATTACCTGCGCTACTTCTCGAGAAGTAGCGCAGGTAATACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031310.1-1916s1c1
Sequence:CCGGCCCTTTCACACACACTTTCTACTCGAGTAGAAAGTGTGTGTGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031310
PLVAP MISSION shRNA shRNA Plasmid DNA
plasmalemma vesicle associated protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031310.1-578s1c1
Sequence:CCGGGACCATTTGCACTAAGGATAACTCGAGTTATCCTTAGTGCAAATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031310.1-521s1c1
Sequence:CCGGGCTCTTCATGCTGAATCAGAACTCGAGTTCTGATTCAGCATGAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149971    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031310.1-1922s1c1
Sequence:CCGGCACACACACTTTCTACCCAATCTCGAGATTGGGTAGAAAGTGTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031310.1-425s1c1
Sequence:CCGGCTACACGAACAATCAGAGGTACTCGAGTACCTCTGATTGTTCGTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031310.1-495s1c1
Sequence:CCGGGACATGAACAAGAGCTGCGATCTCGAGATCGCAGCTCTTGTTCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031310.1-113s1c1
Sequence:CCGGCTGGTATTACCTGCGCTACTTCTCGAGAAGTAGCGCAGGTAATACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031310.1-1916s1c1
Sequence:CCGGCCCTTTCACACACACTTTCTACTCGAGTAGAAAGTGTGTGTGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031310
PLVAP MISSION shRNA Lentiviral Transduction Particles
plasmalemma vesicle associated protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031310.1-578s1c1
Sequence:CCGGGACCATTTGCACTAAGGATAACTCGAGTTATCCTTAGTGCAAATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031310.1-521s1c1
Sequence:CCGGGCTCTTCATGCTGAATCAGAACTCGAGTTCTGATTCAGCATGAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149971    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031310.1-1922s1c1
Sequence:CCGGCACACACACTTTCTACCCAATCTCGAGATTGGGTAGAAAGTGTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031310.1-425s1c1
Sequence:CCGGCTACACGAACAATCAGAGGTACTCGAGTACCTCTGATTGTTCGTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031310.1-495s1c1
Sequence:CCGGGACATGAACAAGAGCTGCGATCTCGAGATCGCAGCTCTTGTTCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031310.1-113s1c1
Sequence:CCGGCTGGTATTACCTGCGCTACTTCTCGAGAAGTAGCGCAGGTAATACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031310.1-1916s1c1
Sequence:CCGGCCCTTTCACACACACTTTCTACTCGAGTAGAAAGTGTGTGTGAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)