EMAIL THIS PAGE TO A FRIEND

PLXDC1

plexin domain containing 1

128 Gene Product Result for
Synonyms: TEM3 TEM7
UniProtKB ID: Q8IUK5, B2R7I8, Q5QCZ7, Q5QCZ8, Q5QCZ9, Q9HCT9
Gene ID:
Mouse(72324) plexin domain containing 1
Rat(303505) plexin domain containing 1
Zebrafish(100286775) plexin domain containing 1
Horse(100068380) plexin domain containing 1
domestic cat(101100347) plexin domain containing 1
dog(491032) plexin domain containing 1
chicken(771862) plexin domain containing 1
domestic guinea pig(100720868) plexin domain containing 1
naked mole-rat(101715652) plexin domain containing 1
Domestic Rabbit(100354889) plexin domain containing 1
cow(536989) plexin domain containing 1
sheep(101122707) plexin domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020405 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020405 Rosetta Predictions human pricing
NM_001107046 Rosetta Predictions rat pricing
NM_028199 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203796 predicted 775
2 SASI_Hs01_00203797 predicted 790
3 SASI_Hs01_00203798 predicted 1604
4 SASI_Hs01_00203799 predicted 905
5 SASI_Hs01_00203800 predicted 339
6 SASI_Hs01_00203801 predicted 346
7 SASI_Hs01_00203802 predicted 1432
8 SASI_Hs01_00203803 predicted 1263
9 SASI_Hs01_00203804 predicted 792
10 SASI_Hs02_00353390 predicted 427
11 SASI_Hs01_00203795 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224956 predicted 892
2 SASI_Rn02_00224957 predicted 435
3 SASI_Rn02_00224958 predicted 1144
4 SASI_Rn02_00224959 predicted 547
5 SASI_Rn02_00224960 predicted 1311
6 SASI_Rn02_00224961 predicted 683
7 SASI_Rn02_00224962 predicted 1305
8 SASI_Rn02_00224963 predicted 339
9 SASI_Rn02_00224964 predicted 207
10 SASI_Rn02_00224965 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033806 predicted 992
2 SASI_Mm01_00033807 predicted 870
3 SASI_Mm01_00033808 predicted 832
4 SASI_Mm01_00033809 predicted 1077
5 SASI_Mm01_00033811 predicted 898
6 SASI_Mm01_00033812 predicted 240
7 SASI_Mm01_00033813 predicted 680
8 SASI_Mm01_00033814 predicted 971
9 SASI_Mm01_00033815 predicted 1244
10 SASI_Mm02_00333509 predicted 1254
11 SASI_Mm01_00033810 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028199
PLXDC1 MISSION shRNA Bacterial Glycerol Stock
plexin domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028199.2-839s1c1
Sequence:CCGGGACGCTTTCATGATTCTCAATCTCGAGATTGAGAATCATGAAAGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028199.2-648s1c1
Sequence:CCGGACTTTGACAATGGGACCGTTTCTCGAGAAACGGTCCCATTGTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028199.2-755s1c1
Sequence:CCGGCGCATTGTCTTCGGCTACAAACTCGAGTTTGTAGCCGAAGACAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028199.2-1734s1c1
Sequence:CCGGGCTCAGTAATACAACTGCGAACTCGAGTTCGCAGTTGTATTACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028199.2-1081s1c1
Sequence:CCGGCCGCCAAGAATGGCTGACCTACTCGAGTAGGTCAGCCATTCTTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028199
PLXDC1 MISSION shRNA shRNA Plasmid DNA
plexin domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028199.2-839s1c1
Sequence:CCGGGACGCTTTCATGATTCTCAATCTCGAGATTGAGAATCATGAAAGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028199.2-648s1c1
Sequence:CCGGACTTTGACAATGGGACCGTTTCTCGAGAAACGGTCCCATTGTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028199.2-755s1c1
Sequence:CCGGCGCATTGTCTTCGGCTACAAACTCGAGTTTGTAGCCGAAGACAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028199.2-1734s1c1
Sequence:CCGGGCTCAGTAATACAACTGCGAACTCGAGTTCGCAGTTGTATTACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028199.2-1081s1c1
Sequence:CCGGCCGCCAAGAATGGCTGACCTACTCGAGTAGGTCAGCCATTCTTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028199
PLXDC1 MISSION shRNA Lentiviral Transduction Particles
plexin domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028199.2-839s1c1
Sequence:CCGGGACGCTTTCATGATTCTCAATCTCGAGATTGAGAATCATGAAAGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028199.2-648s1c1
Sequence:CCGGACTTTGACAATGGGACCGTTTCTCGAGAAACGGTCCCATTGTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028199.2-755s1c1
Sequence:CCGGCGCATTGTCTTCGGCTACAAACTCGAGTTTGTAGCCGAAGACAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028199.2-1734s1c1
Sequence:CCGGGCTCAGTAATACAACTGCGAACTCGAGTTCGCAGTTGTATTACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028199.2-1081s1c1
Sequence:CCGGCCGCCAAGAATGGCTGACCTACTCGAGTAGGTCAGCCATTCTTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020405
PLXDC1 MISSION shRNA Bacterial Glycerol Stock
plexin domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-433s1c1
Sequence:CCGGCCAAGTGAAGATCCACACAATCTCGAGATTGTGTGGATCTTCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-910s1c1
Sequence:CCGGCATCTTTGAATACCACCGCATCTCGAGATGCGGTGGTATTCAAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-338s1c1
Sequence:CCGGGAGGACAACCACAGCTATTATCTCGAGATAATAGCTGTGGTTGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-768s1c1
Sequence:CCGGGCCGCATTGTCTTTGCCTATACTCGAGTATAGGCAAAGACAATGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-1271s1c1
Sequence:CCGGGACACCAAGTTGAATCCCTATCTCGAGATAGGGATTCAACTTGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020405.4-926s21c1
Sequence:CCGGCCCTATGTCTGTCCCGGAAATCTCGAGATTTCCGGGACAGACATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020405.4-2045s21c1
Sequence:CCGGCCTGCACCTAGGCTAGGATAACTCGAGTTATCCTAGCCTAGGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020405.4-1988s21c1
Sequence:CCGGACAGCAGAAGAACTAACATAACTCGAGTTATGTTAGTTCTTCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020405
PLXDC1 MISSION shRNA shRNA Plasmid DNA
plexin domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-433s1c1
Sequence:CCGGCCAAGTGAAGATCCACACAATCTCGAGATTGTGTGGATCTTCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-910s1c1
Sequence:CCGGCATCTTTGAATACCACCGCATCTCGAGATGCGGTGGTATTCAAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-338s1c1
Sequence:CCGGGAGGACAACCACAGCTATTATCTCGAGATAATAGCTGTGGTTGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-768s1c1
Sequence:CCGGGCCGCATTGTCTTTGCCTATACTCGAGTATAGGCAAAGACAATGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-1271s1c1
Sequence:CCGGGACACCAAGTTGAATCCCTATCTCGAGATAGGGATTCAACTTGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020405.4-926s21c1
Sequence:CCGGCCCTATGTCTGTCCCGGAAATCTCGAGATTTCCGGGACAGACATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020405.4-2045s21c1
Sequence:CCGGCCTGCACCTAGGCTAGGATAACTCGAGTTATCCTAGCCTAGGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020405.4-1988s21c1
Sequence:CCGGACAGCAGAAGAACTAACATAACTCGAGTTATGTTAGTTCTTCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020405
PLXDC1 MISSION shRNA Lentiviral Transduction Particles
plexin domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-433s1c1
Sequence:CCGGCCAAGTGAAGATCCACACAATCTCGAGATTGTGTGGATCTTCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-910s1c1
Sequence:CCGGCATCTTTGAATACCACCGCATCTCGAGATGCGGTGGTATTCAAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-338s1c1
Sequence:CCGGGAGGACAACCACAGCTATTATCTCGAGATAATAGCTGTGGTTGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-768s1c1
Sequence:CCGGGCCGCATTGTCTTTGCCTATACTCGAGTATAGGCAAAGACAATGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020405.3-1271s1c1
Sequence:CCGGGACACCAAGTTGAATCCCTATCTCGAGATAGGGATTCAACTTGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020405.4-926s21c1
Sequence:CCGGCCCTATGTCTGTCCCGGAAATCTCGAGATTTCCGGGACAGACATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020405.4-2045s21c1
Sequence:CCGGCCTGCACCTAGGCTAGGATAACTCGAGTTATCCTAGCCTAGGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020405.4-1988s21c1
Sequence:CCGGACAGCAGAAGAACTAACATAACTCGAGTTATGTTAGTTCTTCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)