EMAIL THIS PAGE TO A FRIEND

PLXDC2

plexin domain containing 2

63 Gene Product Result for
Synonyms: TEM7R
UniProtKB ID: Q6UX71, Q96E59, Q96PD9, Q96SU9
Gene ID:
Mouse(67448) plexin domain containing 2
Rat(361282) plexin domain containing 2
cow(515731) plexin domain containing 2
sheep(101101908) plexin domain containing 2
Domestic Rabbit(100341803) plexin domain containing 2
naked mole-rat(101711598) plexin domain containing 2
domestic guinea pig(100723237) plexin domain containing 2
chicken(420511) plexin domain containing 2
Horse(100055892) plexin domain containing 2
domestic cat(101094680) plexin domain containing 2
dog(608632) plexin domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032812 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032812 Rosetta Predictions human pricing
NM_001108422 Rosetta Predictions rat pricing
NM_026162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150562 predicted 1104
2 SASI_Hs02_00360384 predicted 1224
3 SASI_Hs01_00150564 predicted 741
4 SASI_Hs02_00360385 predicted 1834
5 SASI_Hs01_00150565 predicted 1787
6 SASI_Hs01_00150566 predicted 1203
7 SASI_Hs01_00150568 predicted 1650
8 SASI_Hs01_00150569 predicted 957
9 SASI_Hs01_00150570 predicted 1321
10 SASI_Hs01_00150571 predicted 794
11 SASI_Hs01_00150563 predicted 1076
12 SASI_Hs01_00150567 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238479 predicted 1240
2 SASI_Rn02_00238480 predicted 1317
3 SASI_Rn02_00238481 predicted 1735
4 SASI_Rn02_00238482 predicted 2046
5 SASI_Rn02_00238483 predicted 1780
6 SASI_Rn02_00238484 predicted 1957
7 SASI_Rn02_00238485 predicted 1118
8 SASI_Rn02_00238486 predicted 2454
9 SASI_Rn02_00238487 predicted 2267
10 SASI_Rn02_00238488 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177644 predicted 1275
2 SASI_Mm01_00177645 predicted 2422
3 SASI_Mm01_00177646 predicted 1121
4 SASI_Mm01_00177647 predicted 1157
5 SASI_Mm01_00177648 predicted 1367
6 SASI_Mm02_00329788 predicted 1421
7 SASI_Mm01_00177649 predicted 1386
8 SASI_Mm01_00177650 predicted 1821
9 SASI_Mm01_00177651 predicted 898
10 SASI_Mm01_00177652 predicted 1779
11 SASI_Mm01_00177653 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032812
PLXDC2 MISSION shRNA Bacterial Glycerol Stock
plexin domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032812.7-1469s21c1
Sequence:CCGGGTCGGACTGTCCGATGCATTTCTCGAGAAATGCATCGGACAGTCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032812.7-1331s21c1
Sequence:CCGGGTACATCTCCAGGATAATTATCTCGAGATAATTATCCTGGAGATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032812.7-1523s21c1
Sequence:CCGGGTTCGAAGAAGAACAATTTATCTCGAGATAAATTGTTCTTCTTCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-1917s1c1
Sequence:CCGGCCAAGATAGCACTACATCTAACTCGAGTTAGATGTAGTGCTATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-1549s1c1
Sequence:CCGGCCACCGAGTAGAGCTACAAATCTCGAGATTTGTAGCTCTACTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-2045s1c1
Sequence:CCGGGCCATTCTTGTGACAGTCTATCTCGAGATAGACTGTCACAAGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-1397s1c1
Sequence:CCGGCGAATCATCTTTGGATACAAACTCGAGTTTGTATCCAAAGATGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-937s1c1
Sequence:CCGGGCAGGACAATAACACTCAGATCTCGAGATCTGAGTGTTATTGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032812.7-1111s21c1
Sequence:CCGGAGTGAATCTGTCCTTCGATTTCTCGAGAAATCGAAGGACAGATTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032812
PLXDC2 MISSION shRNA shRNA Plasmid DNA
plexin domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032812.7-1469s21c1
Sequence:CCGGGTCGGACTGTCCGATGCATTTCTCGAGAAATGCATCGGACAGTCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032812.7-1331s21c1
Sequence:CCGGGTACATCTCCAGGATAATTATCTCGAGATAATTATCCTGGAGATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032812.7-1523s21c1
Sequence:CCGGGTTCGAAGAAGAACAATTTATCTCGAGATAAATTGTTCTTCTTCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-1917s1c1
Sequence:CCGGCCAAGATAGCACTACATCTAACTCGAGTTAGATGTAGTGCTATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-1549s1c1
Sequence:CCGGCCACCGAGTAGAGCTACAAATCTCGAGATTTGTAGCTCTACTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-2045s1c1
Sequence:CCGGGCCATTCTTGTGACAGTCTATCTCGAGATAGACTGTCACAAGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-1397s1c1
Sequence:CCGGCGAATCATCTTTGGATACAAACTCGAGTTTGTATCCAAAGATGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-937s1c1
Sequence:CCGGGCAGGACAATAACACTCAGATCTCGAGATCTGAGTGTTATTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032812.7-1111s21c1
Sequence:CCGGAGTGAATCTGTCCTTCGATTTCTCGAGAAATCGAAGGACAGATTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032812
PLXDC2 MISSION shRNA Lentiviral Transduction Particles
plexin domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032812.7-1469s21c1
Sequence:CCGGGTCGGACTGTCCGATGCATTTCTCGAGAAATGCATCGGACAGTCCGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000412411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032812.7-1331s21c1
Sequence:CCGGGTACATCTCCAGGATAATTATCTCGAGATAATTATCCTGGAGATGTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032812.7-1523s21c1
Sequence:CCGGGTTCGAAGAAGAACAATTTATCTCGAGATAAATTGTTCTTCTTCGAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-1917s1c1
Sequence:CCGGCCAAGATAGCACTACATCTAACTCGAGTTAGATGTAGTGCTATCTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-1549s1c1
Sequence:CCGGCCACCGAGTAGAGCTACAAATCTCGAGATTTGTAGCTCTACTCGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-2045s1c1
Sequence:CCGGGCCATTCTTGTGACAGTCTATCTCGAGATAGACTGTCACAAGAATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-1397s1c1
Sequence:CCGGCGAATCATCTTTGGATACAAACTCGAGTTTGTATCCAAAGATGATTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000060388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032812.7-937s1c1
Sequence:CCGGGCAGGACAATAACACTCAGATCTCGAGATCTGAGTGTTATTGTCCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000424193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032812.7-1111s21c1
Sequence:CCGGAGTGAATCTGTCCTTCGATTTCTCGAGAAATCGAAGGACAGATTCACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026162
PLXDC2 MISSION shRNA Bacterial Glycerol Stock
plexin domain containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-1105s1c1
Sequence:CCGGCAGGACAATAACACCCAGATACTCGAGTATCTGGGTGTTATTGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-1563s1c1
Sequence:CCGGGCGCATCATCTTTGGATACAACTCGAGTTGTATCCAAAGATGATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-899s1c1
Sequence:CCGGCTGGACACCATACCAATGATTCTCGAGAATCATTGGTATGGTGTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-982s1c1
Sequence:CCGGGCATACAACCACAGGTGGAAACTCGAGTTTCCACCTGTGGTTGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-2083s1c1
Sequence:CCGGGACACGAAGATAGCCCTACATCTCGAGATGTAGGGCTATCTTCGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.5-2188s1c1
Sequence:CCGGCTCATCTTGGTCCTCATTATACTCGAGTATAATGAGGACCAAGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026162.5-2421s1c1
Sequence:CCGGGTACTGGCTTACAGGTGTTAACTCGAGTTAACACCTGTAAGCCAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.5-1690s1c1
Sequence:CCGGGTTCGAAGAAGAACAATTTATCTCGAGATAAATTGTTCTTCTTCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026162
PLXDC2 MISSION shRNA shRNA Plasmid DNA
plexin domain containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-1105s1c1
Sequence:CCGGCAGGACAATAACACCCAGATACTCGAGTATCTGGGTGTTATTGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-1563s1c1
Sequence:CCGGGCGCATCATCTTTGGATACAACTCGAGTTGTATCCAAAGATGATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-899s1c1
Sequence:CCGGCTGGACACCATACCAATGATTCTCGAGAATCATTGGTATGGTGTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-982s1c1
Sequence:CCGGGCATACAACCACAGGTGGAAACTCGAGTTTCCACCTGTGGTTGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-2083s1c1
Sequence:CCGGGACACGAAGATAGCCCTACATCTCGAGATGTAGGGCTATCTTCGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.5-2188s1c1
Sequence:CCGGCTCATCTTGGTCCTCATTATACTCGAGTATAATGAGGACCAAGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026162.5-2421s1c1
Sequence:CCGGGTACTGGCTTACAGGTGTTAACTCGAGTTAACACCTGTAAGCCAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.5-1690s1c1
Sequence:CCGGGTTCGAAGAAGAACAATTTATCTCGAGATAAATTGTTCTTCTTCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026162
PLXDC2 MISSION shRNA Lentiviral Transduction Particles
plexin domain containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-1105s1c1
Sequence:CCGGCAGGACAATAACACCCAGATACTCGAGTATCTGGGTGTTATTGTCCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000180626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-1563s1c1
Sequence:CCGGGCGCATCATCTTTGGATACAACTCGAGTTGTATCCAAAGATGATGCGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-899s1c1
Sequence:CCGGCTGGACACCATACCAATGATTCTCGAGAATCATTGGTATGGTGTCCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000184249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-982s1c1
Sequence:CCGGGCATACAACCACAGGTGGAAACTCGAGTTTCCACCTGTGGTTGTATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.2-2083s1c1
Sequence:CCGGGACACGAAGATAGCCCTACATCTCGAGATGTAGGGCTATCTTCGTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.5-2188s1c1
Sequence:CCGGCTCATCTTGGTCCTCATTATACTCGAGTATAATGAGGACCAAGATGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026162.5-2421s1c1
Sequence:CCGGGTACTGGCTTACAGGTGTTAACTCGAGTTAACACCTGTAAGCCAGTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000215629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026162.5-1690s1c1
Sequence:CCGGGTTCGAAGAAGAACAATTTATCTCGAGATAAATTGTTCTTCTTCGAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???