EMAIL THIS PAGE TO A FRIEND

PLXNA2

plexin A2

121 Gene Product Result for
Synonyms: OCT PLXN2
Gene ID:
Human(5362) Summary: This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
Mouse(18845) plexin A2
Rat(289392) plexin A2
cow(407770) plexin A2
sheep(101122043) plexin A2
chicken(419857) plexin A2
Horse(100051646) plexin A2
dog(490270) plexin A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV49932 Anti-PLXNA2 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, horse, human, rabbit, rat, dog
western blot pricing
SAB1401287 Monoclonal Anti-PLXNA2 antibody produced in mouse clone 2G5, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025179 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025179 Rosetta Predictions human pricing
NM_001105988 Rosetta Predictions rat pricing
NM_008882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153626 predicted 1395
2 SASI_Hs01_00153627 predicted 5509
3 SASI_Hs01_00153628 predicted 2962
4 SASI_Hs01_00153629 predicted 2838
5 SASI_Hs01_00153630 predicted 4182
6 SASI_Hs02_00357928 predicted 3044
7 SASI_Hs02_00357929 predicted 6409
8 SASI_Hs02_00357930 predicted 1836
9 SASI_Hs01_00153634 predicted 4564
10 SASI_Hs01_00153635 predicted 5489
11 SASI_Hs01_00153631 predicted 1960
12 SASI_Hs01_00153632 predicted 5768
13 SASI_Hs01_00153633 predicted 3398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214522 predicted 4758
2 SASI_Rn02_00214523 predicted 3989
3 SASI_Rn02_00214524 predicted 4562
4 SASI_Rn02_00214525 predicted 3574
5 SASI_Rn02_00214526 predicted 3780
6 SASI_Rn02_00214527 predicted 5106
7 SASI_Rn02_00214528 predicted 5343
8 SASI_Rn02_00214529 predicted 3585
9 SASI_Rn02_00214530 predicted 3248
10 SASI_Rn02_00214531 predicted 3565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053042 predicted 2241
2 SASI_Mm01_00053044 predicted 3874
3 SASI_Mm01_00053047 predicted 2586
4 SASI_Mm01_00053048 predicted 2185
5 SASI_Mm01_00053049 predicted 3596
6 SASI_Mm01_00053050 predicted 4591
7 SASI_Mm01_00053051 predicted 2798
8 SASI_Mm02_00314874 predicted 4450
9 SASI_Mm02_00314875 predicted 5903
10 SASI_Mm02_00314876 predicted 794
11 SASI_Mm01_00053043 predicted 5963
12 SASI_Mm01_00053045 predicted 2018
13 SASI_Mm01_00053046 predicted 5290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025179
PLXNA2 MISSION shRNA Bacterial Glycerol Stock
plexin A2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025179.3-5350s21c1
Sequence:CCGGAGATTCTTGATGCCGTGTATACTCGAGTATACACGGCATCAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-2567s1c1
Sequence:CCGGCGGCAATTTCATCATTGACAACTCGAGTTGTCAATGATGAAATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-4814s1c1
Sequence:CCGGCGTGTATAAGAATGTGCCCTACTCGAGTAGGGCACATTCTTATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-920s1c1
Sequence:CCGGCCACTTTGACATCTTCTACATCTCGAGATGTAGAAGATGTCAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-3690s1c1
Sequence:CCGGCCCATCATTCTGAAGGGCAAACTCGAGTTTGCCCTTCAGAATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-3552s1c1
Sequence:CCGGCGCCCAGATGAGTTTGGATTTCTCGAGAAATCCAAACTCATCTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025179.3-5300s21c1
Sequence:CCGGGATCCCAGTGAAGGTGTTAAACTCGAGTTTAACACCTTCACTGGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025179.3-953s21c1
Sequence:CCGGGGCCATCAACCGGGTCTATAACTCGAGTTATAGACCCGGTTGATGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025179.3-3104s21c1
Sequence:CCGGTGTGGTGTGGAACGGCAATTTCTCGAGAAATTGCCGTTCCACACCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025179
PLXNA2 MISSION shRNA shRNA Plasmid DNA
plexin A2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025179.3-5350s21c1
Sequence:CCGGAGATTCTTGATGCCGTGTATACTCGAGTATACACGGCATCAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-2567s1c1
Sequence:CCGGCGGCAATTTCATCATTGACAACTCGAGTTGTCAATGATGAAATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-4814s1c1
Sequence:CCGGCGTGTATAAGAATGTGCCCTACTCGAGTAGGGCACATTCTTATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-920s1c1
Sequence:CCGGCCACTTTGACATCTTCTACATCTCGAGATGTAGAAGATGTCAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-3690s1c1
Sequence:CCGGCCCATCATTCTGAAGGGCAAACTCGAGTTTGCCCTTCAGAATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-3552s1c1
Sequence:CCGGCGCCCAGATGAGTTTGGATTTCTCGAGAAATCCAAACTCATCTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025179.3-5300s21c1
Sequence:CCGGGATCCCAGTGAAGGTGTTAAACTCGAGTTTAACACCTTCACTGGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025179.3-953s21c1
Sequence:CCGGGGCCATCAACCGGGTCTATAACTCGAGTTATAGACCCGGTTGATGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025179.3-3104s21c1
Sequence:CCGGTGTGGTGTGGAACGGCAATTTCTCGAGAAATTGCCGTTCCACACCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025179
PLXNA2 MISSION shRNA Lentiviral Transduction Particles
plexin A2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025179.3-5350s21c1
Sequence:CCGGAGATTCTTGATGCCGTGTATACTCGAGTATACACGGCATCAAGAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-2567s1c1
Sequence:CCGGCGGCAATTTCATCATTGACAACTCGAGTTGTCAATGATGAAATTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-4814s1c1
Sequence:CCGGCGTGTATAAGAATGTGCCCTACTCGAGTAGGGCACATTCTTATACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-920s1c1
Sequence:CCGGCCACTTTGACATCTTCTACATCTCGAGATGTAGAAGATGTCAAAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-3690s1c1
Sequence:CCGGCCCATCATTCTGAAGGGCAAACTCGAGTTTGCCCTTCAGAATGATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025179.2-3552s1c1
Sequence:CCGGCGCCCAGATGAGTTTGGATTTCTCGAGAAATCCAAACTCATCTGGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025179.3-5300s21c1
Sequence:CCGGGATCCCAGTGAAGGTGTTAAACTCGAGTTTAACACCTTCACTGGGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025179.3-953s21c1
Sequence:CCGGGGCCATCAACCGGGTCTATAACTCGAGTTATAGACCCGGTTGATGGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025179.3-3104s21c1
Sequence:CCGGTGTGGTGTGGAACGGCAATTTCTCGAGAAATTGCCGTTCCACACCACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008882
VALIDATED
PLXNA2 MISSION shRNA Bacterial Glycerol Stock
plexin A2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008882.2-5235s21c1
Sequence:CCGGAGATCCTCGATGCCGTATATACTCGAGTATATACGGCATCGAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008882.2-6776s21c1
Sequence:CCGGCTATTCCCTTCTTAGTAATATCTCGAGATATTACTAAGAAGGGAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008882.1-3892s1c1
Sequence:CCGGCGGCCAGATGAGTTTGGATTTCTCGAGAAATCCAAACTCATCTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008882.2-6191s21c1
Sequence:CCGGCTCAACGAGATCTACTCATATCTCGAGATATGAGTAGATCTCGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008882.1-5392s1c1
Sequence:CCGGCGGACATCCATTAGCAGATATCTCGAGATATCTGCTAATGGATGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008882.1-6013s1c1
Sequence:CCGGCCAGCCATTAGTGACCAAGATCTCGAGATCTTGGTCACTAATGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008882.1-3095s1c1
Sequence:CCGGCCAGCCACAATGTCAAGTGTTCTCGAGAACACTTGACATTGTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008882.1-6274s1c1
Sequence:CCGGGCTATCACACTGGCTTCTCAACTCGAGTTGAGAAGCCAGTGTGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008882.2-1831s21c1
Sequence:CCGGGCCTGTCCCAATCGATGATAACTCGAGTTATCATCGATTGGGACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008882.2-3737s21c1
Sequence:CCGGAGTCTGCAGTTCGAGTATATACTCGAGTATATACTCGAACTGCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008882
VALIDATED
PLXNA2 MISSION shRNA shRNA Plasmid DNA
plexin A2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008882.2-5235s21c1
Sequence:CCGGAGATCCTCGATGCCGTATATACTCGAGTATATACGGCATCGAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008882.2-6776s21c1
Sequence:CCGGCTATTCCCTTCTTAGTAATATCTCGAGATATTACTAAGAAGGGAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008882.1-3892s1c1
Sequence:CCGGCGGCCAGATGAGTTTGGATTTCTCGAGAAATCCAAACTCATCTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008882.2-6191s21c1
Sequence:CCGGCTCAACGAGATCTACTCATATCTCGAGATATGAGTAGATCTCGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008882.1-5392s1c1
Sequence:CCGGCGGACATCCATTAGCAGATATCTCGAGATATCTGCTAATGGATGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008882.1-6013s1c1
Sequence:CCGGCCAGCCATTAGTGACCAAGATCTCGAGATCTTGGTCACTAATGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008882.1-3095s1c1
Sequence:CCGGCCAGCCACAATGTCAAGTGTTCTCGAGAACACTTGACATTGTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008882.1-6274s1c1
Sequence:CCGGGCTATCACACTGGCTTCTCAACTCGAGTTGAGAAGCCAGTGTGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008882.2-1831s21c1
Sequence:CCGGGCCTGTCCCAATCGATGATAACTCGAGTTATCATCGATTGGGACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008882.2-3737s21c1
Sequence:CCGGAGTCTGCAGTTCGAGTATATACTCGAGTATATACTCGAACTGCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008882
VALIDATED
PLXNA2 MISSION shRNA Lentiviral Transduction Particles
plexin A2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008882.2-5235s21c1
Sequence:CCGGAGATCCTCGATGCCGTATATACTCGAGTATATACGGCATCGAGGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008882.2-6776s21c1
Sequence:CCGGCTATTCCCTTCTTAGTAATATCTCGAGATATTACTAAGAAGGGAATAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008882.1-3892s1c1
Sequence:CCGGCGGCCAGATGAGTTTGGATTTCTCGAGAAATCCAAACTCATCTGGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008882.2-6191s21c1
Sequence:CCGGCTCAACGAGATCTACTCATATCTCGAGATATGAGTAGATCTCGTTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008882.1-5392s1c1
Sequence:CCGGCGGACATCCATTAGCAGATATCTCGAGATATCTGCTAATGGATGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008882.1-6013s1c1
Sequence:CCGGCCAGCCATTAGTGACCAAGATCTCGAGATCTTGGTCACTAATGGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008882.1-3095s1c1
Sequence:CCGGCCAGCCACAATGTCAAGTGTTCTCGAGAACACTTGACATTGTGGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008882.1-6274s1c1
Sequence:CCGGGCTATCACACTGGCTTCTCAACTCGAGTTGAGAAGCCAGTGTGATAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008882.2-1831s21c1
Sequence:CCGGGCCTGTCCCAATCGATGATAACTCGAGTTATCATCGATTGGGACAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008882.2-3737s21c1
Sequence:CCGGAGTCTGCAGTTCGAGTATATACTCGAGTATATACTCGAACTGCAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)