EMAIL THIS PAGE TO A FRIEND

PLXNA3

plexin A3

102 Gene Product Result for
Synonyms: 6.3 HSSEXGENE PLXN3 PLXN4 XAP-6
UniProtKB ID: P51805, Q5HY36
Gene ID:
Human(55558) Summary: The protein encoded by this gene is a member of the plexin class of proteins. The encoded protein is a transmembrane protein that is exposed on the cell surface. This gene is thought to be involved in epithelial and neural tissue development. [provided by RefSeq, May 2010]
Mouse(18846) plexin A3
Rat(309280) plexin A3
Zebrafish(567422) plexin A3
dog(492251) plexin A3
Horse(100058349) plexin A3
cow(782382) plexin A3
sheep(101119375) plexin A3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301610 Anti-PLXNA3 affinity isolated antibody human, mouse, rat
immunohistochemistry pricing
HPA058989 Anti-PLXNA3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017514 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017514 Rosetta Predictions human pricing
NM_001107581 Rosetta Predictions rat pricing
NM_008883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180115 predicted 2754
2 SASI_Hs01_00180116 predicted 1309
3 SASI_Hs02_00350132 predicted 2420
4 SASI_Hs01_00180117 predicted 4192
5 SASI_Hs01_00180118 predicted 977
6 SASI_Hs01_00180119 predicted 3648
7 SASI_Hs01_00180120 predicted 3173
8 SASI_Hs01_00180121 predicted 3020
9 SASI_Hs01_00180122 predicted 5775
10 SASI_Hs01_00180123 predicted 4894
11 SASI_Hs01_00180124 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230245 predicted 949
2 SASI_Rn02_00230246 predicted 917
3 SASI_Rn02_00230247 predicted 1314
4 SASI_Rn02_00230248 predicted 620
5 SASI_Rn02_00230249 predicted 934
6 SASI_Rn02_00230250 predicted 5014
7 SASI_Rn02_00230251 predicted 5540
8 SASI_Rn02_00230252 predicted 3341
9 SASI_Rn02_00230253 predicted 4834
10 SASI_Rn02_00230254 predicted 3073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021975 predicted 1320
2 SASI_Mm01_00021976 predicted 615
3 SASI_Mm02_00314877 predicted 1948
4 SASI_Mm01_00021977 predicted 2424
5 SASI_Mm01_00021978 predicted 2007
6 SASI_Mm01_00021979 predicted 4876
7 SASI_Mm01_00021980 predicted 927
8 SASI_Mm01_00021981 predicted 4713
9 SASI_Mm01_00021982 predicted 5632
10 SASI_Mm01_00021983 predicted 3593
11 SASI_Mm01_00021974 predicted 4634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008883
VALIDATED
PLXNA3 MISSION shRNA Bacterial Glycerol Stock
plexin A3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008883.2-4159s21c1
Sequence:CCGGGAGAAGGCCCTGCGTCTATTTCTCGAGAAATAGACGCAGGGCCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008883.2-929s21c1
Sequence:CCGGTGGATACAGCAGGCGAGAAATCTCGAGATTTCTCGCCTGCTGTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008883.2-2374s21c1
Sequence:CCGGGTACCTGCAGTGCGCTTTAACCTCGAGGTTAAAGCGCACTGCAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008883.2-6504s21c1
Sequence:CCGGCACGTCCCTACTGCCAAATTTCTCGAGAAATTTGGCAGTAGGGACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008883.2-1470s21c1
Sequence:CCGGCGGTACACGCAGCGGTAATTTCTCGAGAAATTACCGCTGCGTGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-4875s1c1
Sequence:CCGGCCCAAACAAGTGTCTGCCTATCTCGAGATAGGCAGACACTTGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-3000s1c1
Sequence:CCGGCGGCTTACCATCTCTGGAATTCTCGAGAATTCCAGAGATGGTAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-4391s1c1
Sequence:CCGGGCTCACCAACTGGTTCACATTCTCGAGAATGTGAACCAGTTGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-3326s1c1
Sequence:CCGGCCGTGGTATTGAGACCACTAACTCGAGTTAGTGGTCTCAATACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-216s1c1
Sequence:CCGGCGTACCTTTGTGGTAACAGATCTCGAGATCTGTTACCACAAAGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008883
VALIDATED
PLXNA3 MISSION shRNA shRNA Plasmid DNA
plexin A3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008883.2-4159s21c1
Sequence:CCGGGAGAAGGCCCTGCGTCTATTTCTCGAGAAATAGACGCAGGGCCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008883.2-929s21c1
Sequence:CCGGTGGATACAGCAGGCGAGAAATCTCGAGATTTCTCGCCTGCTGTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008883.2-2374s21c1
Sequence:CCGGGTACCTGCAGTGCGCTTTAACCTCGAGGTTAAAGCGCACTGCAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008883.2-6504s21c1
Sequence:CCGGCACGTCCCTACTGCCAAATTTCTCGAGAAATTTGGCAGTAGGGACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008883.2-1470s21c1
Sequence:CCGGCGGTACACGCAGCGGTAATTTCTCGAGAAATTACCGCTGCGTGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-4875s1c1
Sequence:CCGGCCCAAACAAGTGTCTGCCTATCTCGAGATAGGCAGACACTTGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-3000s1c1
Sequence:CCGGCGGCTTACCATCTCTGGAATTCTCGAGAATTCCAGAGATGGTAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-4391s1c1
Sequence:CCGGGCTCACCAACTGGTTCACATTCTCGAGAATGTGAACCAGTTGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-3326s1c1
Sequence:CCGGCCGTGGTATTGAGACCACTAACTCGAGTTAGTGGTCTCAATACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-216s1c1
Sequence:CCGGCGTACCTTTGTGGTAACAGATCTCGAGATCTGTTACCACAAAGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008883
VALIDATED
PLXNA3 MISSION shRNA Lentiviral Transduction Particles
plexin A3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008883.2-4159s21c1
Sequence:CCGGGAGAAGGCCCTGCGTCTATTTCTCGAGAAATAGACGCAGGGCCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008883.2-929s21c1
Sequence:CCGGTGGATACAGCAGGCGAGAAATCTCGAGATTTCTCGCCTGCTGTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008883.2-2374s21c1
Sequence:CCGGGTACCTGCAGTGCGCTTTAACCTCGAGGTTAAAGCGCACTGCAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008883.2-6504s21c1
Sequence:CCGGCACGTCCCTACTGCCAAATTTCTCGAGAAATTTGGCAGTAGGGACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008883.2-1470s21c1
Sequence:CCGGCGGTACACGCAGCGGTAATTTCTCGAGAAATTACCGCTGCGTGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-4875s1c1
Sequence:CCGGCCCAAACAAGTGTCTGCCTATCTCGAGATAGGCAGACACTTGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-3000s1c1
Sequence:CCGGCGGCTTACCATCTCTGGAATTCTCGAGAATTCCAGAGATGGTAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-4391s1c1
Sequence:CCGGGCTCACCAACTGGTTCACATTCTCGAGAATGTGAACCAGTTGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-3326s1c1
Sequence:CCGGCCGTGGTATTGAGACCACTAACTCGAGTTAGTGGTCTCAATACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008883.1-216s1c1
Sequence:CCGGCGTACCTTTGTGGTAACAGATCTCGAGATCTGTTACCACAAAGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017514
VALIDATED
PLXNA3 MISSION shRNA Bacterial Glycerol Stock
plexin A3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017514.2-4434s21c1
Sequence:CCGGCGTTCCTGCTGCATAAGTTTCCTCGAGGAAACTTATGCAGCAGGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017514.2-6077s21c1
Sequence:CCGGTTATATCCCTCTGCCTATTTACTCGAGTAAATAGGCAGAGGGATATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017514.2-5646s21c1
Sequence:CCGGGTGCGCTCAACGAGCTGTATTCTCGAGAATACAGCTCGTTGAGCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017514.2-977s21c1
Sequence:CCGGGACTCAGAGTTCTACTCATACCTCGAGGTATGAGTAGAACTCTGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017514.2-315s21c1
Sequence:CCGGGCGCAGTGAACCGAGTCTTTACTCGAGTAAAGACTCGGTTCACTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017514.1-5671s1c1
Sequence:CCGGGCTGTATTTCTATGTCACCAACTCGAGTTGGTGACATAGAAATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017514.1-5549s1c1
Sequence:CCGGGAGAGGTATTATCGAGACATTCTCGAGAATGTCTCGATAATACCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_017514.1-4429s1c1
Sequence:CCGGGCTTACCAACTGGTTCACGTTCTCGAGAACGTGAACCAGTTGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017514.1-4023s1c1
Sequence:CCGGCGGACATCAATGAGCTGACTACTCGAGTAGTCAGCTCATTGATGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017514.1-328s1c1
Sequence:CCGGCGCAGTGAACCGAGTCTTTAACTCGAGTTAAAGACTCGGTTCACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017514
VALIDATED
PLXNA3 MISSION shRNA shRNA Plasmid DNA
plexin A3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017514.2-4434s21c1
Sequence:CCGGCGTTCCTGCTGCATAAGTTTCCTCGAGGAAACTTATGCAGCAGGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017514.2-6077s21c1
Sequence:CCGGTTATATCCCTCTGCCTATTTACTCGAGTAAATAGGCAGAGGGATATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017514.2-5646s21c1
Sequence:CCGGGTGCGCTCAACGAGCTGTATTCTCGAGAATACAGCTCGTTGAGCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017514.2-977s21c1
Sequence:CCGGGACTCAGAGTTCTACTCATACCTCGAGGTATGAGTAGAACTCTGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017514.2-315s21c1
Sequence:CCGGGCGCAGTGAACCGAGTCTTTACTCGAGTAAAGACTCGGTTCACTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017514.1-5671s1c1
Sequence:CCGGGCTGTATTTCTATGTCACCAACTCGAGTTGGTGACATAGAAATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017514.1-5549s1c1
Sequence:CCGGGAGAGGTATTATCGAGACATTCTCGAGAATGTCTCGATAATACCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_017514.1-4429s1c1
Sequence:CCGGGCTTACCAACTGGTTCACGTTCTCGAGAACGTGAACCAGTTGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017514.1-4023s1c1
Sequence:CCGGCGGACATCAATGAGCTGACTACTCGAGTAGTCAGCTCATTGATGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017514.1-328s1c1
Sequence:CCGGCGCAGTGAACCGAGTCTTTAACTCGAGTTAAAGACTCGGTTCACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017514
VALIDATED
PLXNA3 MISSION shRNA Lentiviral Transduction Particles
plexin A3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017514.2-4434s21c1
Sequence:CCGGCGTTCCTGCTGCATAAGTTTCCTCGAGGAAACTTATGCAGCAGGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017514.2-6077s21c1
Sequence:CCGGTTATATCCCTCTGCCTATTTACTCGAGTAAATAGGCAGAGGGATATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017514.2-5646s21c1
Sequence:CCGGGTGCGCTCAACGAGCTGTATTCTCGAGAATACAGCTCGTTGAGCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017514.2-977s21c1
Sequence:CCGGGACTCAGAGTTCTACTCATACCTCGAGGTATGAGTAGAACTCTGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017514.2-315s21c1
Sequence:CCGGGCGCAGTGAACCGAGTCTTTACTCGAGTAAAGACTCGGTTCACTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017514.1-5671s1c1
Sequence:CCGGGCTGTATTTCTATGTCACCAACTCGAGTTGGTGACATAGAAATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017514.1-5549s1c1
Sequence:CCGGGAGAGGTATTATCGAGACATTCTCGAGAATGTCTCGATAATACCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_017514.1-4429s1c1
Sequence:CCGGGCTTACCAACTGGTTCACGTTCTCGAGAACGTGAACCAGTTGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017514.1-4023s1c1
Sequence:CCGGCGGACATCAATGAGCTGACTACTCGAGTAGTCAGCTCATTGATGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017514.1-328s1c1
Sequence:CCGGCGCAGTGAACCGAGTCTTTAACTCGAGTTAAAGACTCGGTTCACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)