EMAIL THIS PAGE TO A FRIEND

PLXNA4

plexin A4

76 Gene Product Result for
Synonyms: FAYV2820 PLEXA4 PLXNA4A PLXNA4B PRO34003
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181775 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU004141 MISSION® esiRNA esiRNA targeting mouse Plxna4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105543 Rosetta Predictions human pricing
NM_020911 Rosetta Predictions human pricing
NM_181775 Rosetta Predictions human pricing
NM_175750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324311 predicted 866
2 SASI_Hs02_00324312 predicted 783
3 SASI_Hs02_00324313 predicted 739
4 SASI_Hs02_00324314 predicted 1215
5 SASI_Hs02_00324315 predicted 976
6 SASI_Hs02_00324316 predicted 1324
7 SASI_Hs02_00324317 predicted 924
8 SASI_Hs02_00324318 predicted 1307
9 SASI_Hs02_00324319 predicted 393
10 SASI_Hs02_00324320 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354266 predicted 870
2 SASI_Hs02_00354267 predicted 788
3 SASI_Hs02_00354268 predicted 733
4 SASI_Hs02_00354269 predicted 1214
5 SASI_Hs02_00354270 predicted 969
6 SASI_Hs02_00354271 predicted 1318
7 SASI_Hs02_00354272 predicted 923
8 SASI_Hs02_00354273 predicted 1309
9 SASI_Hs02_00354274 predicted 399
10 SASI_Hs02_00354275 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370365 predicted 1017
2 SASI_Hs02_00370366 predicted 936
3 SASI_Hs02_00370367 predicted 884
4 SASI_Hs02_00370368 predicted 1361
5 SASI_Hs02_00370369 predicted 1123
6 SASI_Hs01_00032543 predicted 1469
7 SASI_Hs02_00370370 predicted 1074
8 SASI_Hs02_00370371 predicted 1453
9 SASI_Hs02_00370372 predicted 539
10 SASI_Hs01_00032544 predicted 1233
11 SASI_Hs01_00032539 predicted 1094
12 SASI_Hs01_00032540 predicted 1561
13 SASI_Hs01_00032541 predicted 845
14 SASI_Hs01_00032542 predicted 1458
15 SASI_Hs01_00032545 predicted 715
16 SASI_Hs01_00032546 predicted 1210
17 SASI_Hs01_00032547 predicted 742
18 SASI_Hs01_00032548 predicted 1769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124567 predicted 2781
2 SASI_Mm01_00124568 predicted 1770
3 SASI_Mm01_00124569 predicted 4211
4 SASI_Mm01_00124570 predicted 5020
5 SASI_Mm01_00124571 predicted 3918
6 SASI_Mm02_00346653 predicted 3256
7 SASI_Mm02_00346654 predicted 5647
8 SASI_Mm01_00124574 predicted 5273
9 SASI_Mm01_00124575 predicted 1827
10 SASI_Mm01_00124576 predicted 3631
11 SASI_Mm01_00124572 predicted 1504
12 SASI_Mm01_00124573 predicted 3003
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175750
PLXNA4 MISSION shRNA Bacterial Glycerol Stock
plexin A4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175750.3-2055s21c1
Sequence:CCGGCAGATCAATGATCGCATTAAGCTCGAGCTTAATGCGATCATTGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175750.3-4369s21c1
Sequence:CCGGAGACCAACTTCACCTATTATCCTCGAGGATAATAGGTGAAGTTGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175750.3-3964s21c1
Sequence:CCGGGGCGCTCTCCATCCTACATTACTCGAGTAATGTAGGATGGAGAGCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175750.2-3541s1c1
Sequence:CCGGCCCTCGTATCACAGAGATCATCTCGAGATGATCTCTGTGATACGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175750.2-2158s1c1
Sequence:CCGGGCTCCTTACTATTGATGACAACTCGAGTTGTCATCAATAGTAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175750.2-1265s1c1
Sequence:CCGGCGGATTGTTCAGACCTGCAATCTCGAGATTGCAGGTCTGAACAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175750.2-6783s1c1
Sequence:CCGGCCTTTCATTTCTCTGCCTCTTCTCGAGAAGAGGCAGAGAAATGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175750.3-5996s21c1
Sequence:CCGGGATCTATCTGACACGACTATTCTCGAGAATAGTCGTGTCAGATAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175750
PLXNA4 MISSION shRNA shRNA Plasmid DNA
plexin A4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175750.3-2055s21c1
Sequence:CCGGCAGATCAATGATCGCATTAAGCTCGAGCTTAATGCGATCATTGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175750.3-4369s21c1
Sequence:CCGGAGACCAACTTCACCTATTATCCTCGAGGATAATAGGTGAAGTTGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175750.3-3964s21c1
Sequence:CCGGGGCGCTCTCCATCCTACATTACTCGAGTAATGTAGGATGGAGAGCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175750.2-3541s1c1
Sequence:CCGGCCCTCGTATCACAGAGATCATCTCGAGATGATCTCTGTGATACGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175750.2-2158s1c1
Sequence:CCGGGCTCCTTACTATTGATGACAACTCGAGTTGTCATCAATAGTAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175750.2-1265s1c1
Sequence:CCGGCGGATTGTTCAGACCTGCAATCTCGAGATTGCAGGTCTGAACAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175750.2-6783s1c1
Sequence:CCGGCCTTTCATTTCTCTGCCTCTTCTCGAGAAGAGGCAGAGAAATGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175750.3-5996s21c1
Sequence:CCGGGATCTATCTGACACGACTATTCTCGAGAATAGTCGTGTCAGATAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175750
PLXNA4 MISSION shRNA Lentiviral Transduction Particles
plexin A4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175750.3-2055s21c1
Sequence:CCGGCAGATCAATGATCGCATTAAGCTCGAGCTTAATGCGATCATTGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175750.3-4369s21c1
Sequence:CCGGAGACCAACTTCACCTATTATCCTCGAGGATAATAGGTGAAGTTGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175750.3-3964s21c1
Sequence:CCGGGGCGCTCTCCATCCTACATTACTCGAGTAATGTAGGATGGAGAGCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175750.2-3541s1c1
Sequence:CCGGCCCTCGTATCACAGAGATCATCTCGAGATGATCTCTGTGATACGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175750.2-2158s1c1
Sequence:CCGGGCTCCTTACTATTGATGACAACTCGAGTTGTCATCAATAGTAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175750.2-1265s1c1
Sequence:CCGGCGGATTGTTCAGACCTGCAATCTCGAGATTGCAGGTCTGAACAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175750.2-6783s1c1
Sequence:CCGGCCTTTCATTTCTCTGCCTCTTCTCGAGAAGAGGCAGAGAAATGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175750.3-5996s21c1
Sequence:CCGGGATCTATCTGACACGACTATTCTCGAGAATAGTCGTGTCAGATAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181775
PLXNA4 MISSION shRNA Bacterial Glycerol Stock
plexin A4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181775.3-943s21c1
Sequence:CCGGTGGATGGGAAGCCCGAGTATTCTCGAGAATACTCGGGCTTCCCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181775.3-1040s21c1
Sequence:CCGGGTTCGTGGCCTCGATGATTAACTCGAGTTAATCATCGAGGCCACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-1460s1c1
Sequence:CCGGGCAGATAAATGACCGCATTAACTCGAGTTAATGCGGTCATTTATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-485s1c1
Sequence:CCGGGCAGCGGTCATTTGTCACATTCTCGAGAATGTGACAAATGACCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-1563s1c1
Sequence:CCGGGCGCTCTTAACCATTGACGATCTCGAGATCGTCAATGGTTAAGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-1089s1c1
Sequence:CCGGCCTGACTTTGATATCTACTATCTCGAGATAGTAGATATCAAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-1565s1c1
Sequence:CCGGGCTCTTAACCATTGACGATAACTCGAGTTATCGTCAATGGTTAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181775.3-1566s21c1
Sequence:CCGGCTCTTAACCATTGACGATAACCTCGAGGTTATCGTCAATGGTTAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181775
PLXNA4 MISSION shRNA shRNA Plasmid DNA
plexin A4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181775.3-943s21c1
Sequence:CCGGTGGATGGGAAGCCCGAGTATTCTCGAGAATACTCGGGCTTCCCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181775.3-1040s21c1
Sequence:CCGGGTTCGTGGCCTCGATGATTAACTCGAGTTAATCATCGAGGCCACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-1460s1c1
Sequence:CCGGGCAGATAAATGACCGCATTAACTCGAGTTAATGCGGTCATTTATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-485s1c1
Sequence:CCGGGCAGCGGTCATTTGTCACATTCTCGAGAATGTGACAAATGACCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-1563s1c1
Sequence:CCGGGCGCTCTTAACCATTGACGATCTCGAGATCGTCAATGGTTAAGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-1089s1c1
Sequence:CCGGCCTGACTTTGATATCTACTATCTCGAGATAGTAGATATCAAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-1565s1c1
Sequence:CCGGGCTCTTAACCATTGACGATAACTCGAGTTATCGTCAATGGTTAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181775.3-1566s21c1
Sequence:CCGGCTCTTAACCATTGACGATAACCTCGAGGTTATCGTCAATGGTTAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181775
PLXNA4 MISSION shRNA Lentiviral Transduction Particles
plexin A4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181775.3-943s21c1
Sequence:CCGGTGGATGGGAAGCCCGAGTATTCTCGAGAATACTCGGGCTTCCCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181775.3-1040s21c1
Sequence:CCGGGTTCGTGGCCTCGATGATTAACTCGAGTTAATCATCGAGGCCACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-1460s1c1
Sequence:CCGGGCAGATAAATGACCGCATTAACTCGAGTTAATGCGGTCATTTATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-485s1c1
Sequence:CCGGGCAGCGGTCATTTGTCACATTCTCGAGAATGTGACAAATGACCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-1563s1c1
Sequence:CCGGGCGCTCTTAACCATTGACGATCTCGAGATCGTCAATGGTTAAGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-1089s1c1
Sequence:CCGGCCTGACTTTGATATCTACTATCTCGAGATAGTAGATATCAAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181775.2-1565s1c1
Sequence:CCGGGCTCTTAACCATTGACGATAACTCGAGTTATCGTCAATGGTTAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181775.3-1566s21c1
Sequence:CCGGCTCTTAACCATTGACGATAACCTCGAGGTTATCGTCAATGGTTAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)