EMAIL THIS PAGE TO A FRIEND

PLXNB1

plexin B1

103 Gene Product Result for
Synonyms: PLEXIN-B1 PLXN5 SEP
UniProtKB ID: O43157, A6H8Y2, Q6NY20, Q9UIV7, Q9UJ92, Q9UJ93
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA040586 Anti-PLXNB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002673 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002673 Rosetta Predictions human pricing
NM_001108188 Rosetta Predictions rat pricing
NM_172775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211056 predicted 347
2 SASI_Hs02_00334239 predicted 787
3 SASI_Hs01_00211057 predicted 1423
4 SASI_Hs01_00211058 predicted 5238
5 SASI_Hs01_00211059 predicted 6537
6 SASI_Hs01_00211060 predicted 3686
7 SASI_Hs01_00211061 predicted 3773
8 SASI_Hs01_00211062 predicted 201
9 SASI_Hs01_00211063 predicted 3113
10 SASI_Hs01_00211064 predicted 6044
11 SASI_Hs01_00211065 predicted 5574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236194 predicted 3222
2 SASI_Rn02_00236195 predicted 3179
3 SASI_Rn02_00236196 predicted 1620
4 SASI_Rn02_00236197 predicted 1630
5 SASI_Rn02_00236198 predicted 1539
6 SASI_Rn02_00236199 predicted 683
7 SASI_Rn02_00236200 predicted 1558
8 SASI_Rn02_00236201 predicted 1529
9 SASI_Rn02_00236202 predicted 1678
10 SASI_Rn02_00236203 predicted 3301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045063 predicted 6035
2 SASI_Mm01_00045064 predicted 3460
3 SASI_Mm01_00045065 predicted 1473
4 SASI_Mm02_00344669 predicted 1383
5 SASI_Mm01_00045066 predicted 4908
6 SASI_Mm01_00045067 predicted 915
7 SASI_Mm01_00045068 predicted 4662
8 SASI_Mm01_00045069 predicted 531
9 SASI_Mm01_00045071 predicted 5200
10 SASI_Mm01_00045072 predicted 1179
11 SASI_Mm01_00045070 predicted 1377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002673
VALIDATED
PLXNB1 MISSION shRNA Bacterial Glycerol Stock
plexin B1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002673.4-5206s21c1
Sequence:CCGGCATGGGAAGCTTGAGTATTTCCTCGAGGAAATACTCAAGCTTCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002673.3-5003s1c1
Sequence:CCGGGCTTGAGTATTTCACTGACATCTCGAGATGTCAGTGAAATACTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002673.3-1116s1c1
Sequence:CCGGGTGGCCTACATCGAGTATGATCTCGAGATCATACTCGATGTAGGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002673.3-132s1c1
Sequence:CCGGCCAACTGCATTCACTCCCAATCTCGAGATTGGGAGTGAATGCAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_002673.3-6152s1c1
Sequence:CCGGCCCGATCAACAAACTTCTGTACTCGAGTACAGAAGTTTGTTGATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_002673.3-6053s1c1
Sequence:CCGGCGTGCAAACATCTGATAACATCTCGAGATGTTATCAGATGTTTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002673.4-5394s21c1
Sequence:CCGGCATGCTCTTTCGAGGGATTAACTCGAGTTAATCCCTCGAAAGAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002673.4-4061s21c1
Sequence:CCGGTCAGTGGAGGACGTGAGATATCTCGAGATATCTCACGTCCTCCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002673.4-7119s21c1
Sequence:CCGGCTGCCACATCCTAGGTCTAAGCTCGAGCTTAGACCTAGGATGTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002673.4-6261s21c1
Sequence:CCGGCGACGTGCAAACATCTGATAACTCGAGTTATCAGATGTTTGCACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002673
VALIDATED
PLXNB1 MISSION shRNA shRNA Plasmid DNA
plexin B1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002673.4-5206s21c1
Sequence:CCGGCATGGGAAGCTTGAGTATTTCCTCGAGGAAATACTCAAGCTTCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002673.3-5003s1c1
Sequence:CCGGGCTTGAGTATTTCACTGACATCTCGAGATGTCAGTGAAATACTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002673.3-1116s1c1
Sequence:CCGGGTGGCCTACATCGAGTATGATCTCGAGATCATACTCGATGTAGGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002673.3-132s1c1
Sequence:CCGGCCAACTGCATTCACTCCCAATCTCGAGATTGGGAGTGAATGCAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_002673.3-6152s1c1
Sequence:CCGGCCCGATCAACAAACTTCTGTACTCGAGTACAGAAGTTTGTTGATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_002673.3-6053s1c1
Sequence:CCGGCGTGCAAACATCTGATAACATCTCGAGATGTTATCAGATGTTTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002673.4-5394s21c1
Sequence:CCGGCATGCTCTTTCGAGGGATTAACTCGAGTTAATCCCTCGAAAGAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002673.4-4061s21c1
Sequence:CCGGTCAGTGGAGGACGTGAGATATCTCGAGATATCTCACGTCCTCCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002673.4-7119s21c1
Sequence:CCGGCTGCCACATCCTAGGTCTAAGCTCGAGCTTAGACCTAGGATGTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002673.4-6261s21c1
Sequence:CCGGCGACGTGCAAACATCTGATAACTCGAGTTATCAGATGTTTGCACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002673
VALIDATED
PLXNB1 MISSION shRNA Lentiviral Transduction Particles
plexin B1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002673.4-5206s21c1
Sequence:CCGGCATGGGAAGCTTGAGTATTTCCTCGAGGAAATACTCAAGCTTCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002673.3-5003s1c1
Sequence:CCGGGCTTGAGTATTTCACTGACATCTCGAGATGTCAGTGAAATACTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002673.3-1116s1c1
Sequence:CCGGGTGGCCTACATCGAGTATGATCTCGAGATCATACTCGATGTAGGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002673.3-132s1c1
Sequence:CCGGCCAACTGCATTCACTCCCAATCTCGAGATTGGGAGTGAATGCAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_002673.3-6152s1c1
Sequence:CCGGCCCGATCAACAAACTTCTGTACTCGAGTACAGAAGTTTGTTGATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_002673.3-6053s1c1
Sequence:CCGGCGTGCAAACATCTGATAACATCTCGAGATGTTATCAGATGTTTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002673.4-5394s21c1
Sequence:CCGGCATGCTCTTTCGAGGGATTAACTCGAGTTAATCCCTCGAAAGAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002673.4-4061s21c1
Sequence:CCGGTCAGTGGAGGACGTGAGATATCTCGAGATATCTCACGTCCTCCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002673.4-7119s21c1
Sequence:CCGGCTGCCACATCCTAGGTCTAAGCTCGAGCTTAGACCTAGGATGTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002673.4-6261s21c1
Sequence:CCGGCGACGTGCAAACATCTGATAACTCGAGTTATCAGATGTTTGCACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172775
VALIDATED
PLXNB1 MISSION shRNA Bacterial Glycerol Stock
plexin B1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172775.1-5559s1c1
Sequence:CCGGCGTCTGAATACACTGCAACATCTCGAGATGTTGCAGTGTATTCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172775.1-7442s1c1
Sequence:CCGGGCCATTCATGTTCCATGAATTCTCGAGAATTCATGGAACATGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172775.1-386s1c1
Sequence:CCGGCCAGCCTACTAACAACCCTAACTCGAGTTAGGGTTGTTAGTAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172775.1-6159s1c1
Sequence:CCGGCCCATCAACAAACTTCTGTATCTCGAGATACAGAAGTTTGTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172775.1-5010s1c1
Sequence:CCGGCTTGAATACTTCACGGACATACTCGAGTATGTCCGTGAAGTATTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172775
VALIDATED
PLXNB1 MISSION shRNA shRNA Plasmid DNA
plexin B1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172775.1-5559s1c1
Sequence:CCGGCGTCTGAATACACTGCAACATCTCGAGATGTTGCAGTGTATTCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172775.1-7442s1c1
Sequence:CCGGGCCATTCATGTTCCATGAATTCTCGAGAATTCATGGAACATGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172775.1-386s1c1
Sequence:CCGGCCAGCCTACTAACAACCCTAACTCGAGTTAGGGTTGTTAGTAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172775.1-6159s1c1
Sequence:CCGGCCCATCAACAAACTTCTGTATCTCGAGATACAGAAGTTTGTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172775.1-5010s1c1
Sequence:CCGGCTTGAATACTTCACGGACATACTCGAGTATGTCCGTGAAGTATTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172775
VALIDATED
PLXNB1 MISSION shRNA Lentiviral Transduction Particles
plexin B1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172775.1-5559s1c1
Sequence:CCGGCGTCTGAATACACTGCAACATCTCGAGATGTTGCAGTGTATTCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172775.1-7442s1c1
Sequence:CCGGGCCATTCATGTTCCATGAATTCTCGAGAATTCATGGAACATGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172775.1-386s1c1
Sequence:CCGGCCAGCCTACTAACAACCCTAACTCGAGTTAGGGTTGTTAGTAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172775.1-6159s1c1
Sequence:CCGGCCCATCAACAAACTTCTGTATCTCGAGATACAGAAGTTTGTTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172775.1-5010s1c1
Sequence:CCGGCTTGAATACTTCACGGACATACTCGAGTATGTCCGTGAAGTATTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)