EMAIL THIS PAGE TO A FRIEND

PLXNB2

plexin B2

145 Gene Product Result for
Synonyms: MM1 Nbla00445 PLEXB2 dJ402G11.3
UniProtKB ID: O15031, A6QRH0, Q7KZU3, Q9BSU7
Gene ID:
Human(23654) Summary: Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]
Mouse(140570) plexin B2
Rat(315217) plexin B2
chicken(425938) plexin B2
Horse(100056317) plexin B2
dog(474459) plexin B2
cow(508175) plexin B2
sheep(101116473) plexin B2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012401 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_371474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371474 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_484491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012401 Rosetta Predictions human pricing
XM_371474 Rosetta Predictions human pricing
NM_001108106 Rosetta Predictions rat pricing
XM_001003429 Rosetta Predictions mouse pricing
XM_001003435 Rosetta Predictions mouse pricing
XM_484491 Rosetta Predictions mouse pricing
XM_902084 Rosetta Predictions mouse pricing
XM_902093 Rosetta Predictions mouse pricing
XM_902096 Rosetta Predictions mouse pricing
XM_902107 Rosetta Predictions mouse pricing
XM_912589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344216 predicted 4203
2 SASI_Hs02_00344217 predicted 2912
3 SASI_Hs02_00344218 predicted 3100
4 SASI_Hs02_00344219 predicted 4126
5 SASI_Hs02_00344220 predicted 5057
6 SASI_Hs02_00344221 predicted 5499
7 SASI_Hs02_00344222 predicted 3515
8 SASI_Hs02_00344223 predicted 376
9 SASI_Hs02_00344224 predicted 683
10 SASI_Hs02_00344225 predicted 5001
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247554 predicted 4495
2 SASI_Hs01_00260333 predicted 4492
3 SASI_Hs01_00247555 predicted 5445
4 SASI_Hs01_00260334 predicted 5439
5 SASI_Hs01_00247556 predicted 4498
6 SASI_Hs01_00260335 predicted 4499
7 SASI_Hs01_00247557 predicted 5444
8 SASI_Hs01_00260336 predicted 5441
9 SASI_Hs01_00247558 predicted 4516
10 SASI_Hs01_00260337 predicted 4512
11 SASI_Hs01_00247559 predicted 4525
12 SASI_Hs01_00260338 predicted 4519
13 SASI_Hs01_00247560 predicted 4996
14 SASI_Hs01_00260339 predicted 4994
15 SASI_Hs01_00247561 predicted 4526
16 SASI_Hs01_00260340 predicted 4525
17 SASI_Hs01_00247562 predicted 4502
18 SASI_Hs01_00260341 predicted 4503
19 SASI_Hs01_00247563 predicted 4489
20 SASI_Hs01_00260342 predicted 4497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235414 predicted 5660
2 SASI_Rn02_00235415 predicted 1090
3 SASI_Rn02_00235416 predicted 1214
4 SASI_Rn02_00235417 predicted 5084
5 SASI_Rn02_00235418 predicted 4793
6 SASI_Rn02_00235419 predicted 4554
7 SASI_Rn02_00235420 predicted 3199
8 SASI_Rn02_00235421 predicted 2922
9 SASI_Rn02_00235422 predicted 4333
10 SASI_Rn02_00235423 predicted 1801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272833 predicted 6121
2 SASI_Mm01_00272834 predicted 6095
3 SASI_Mm01_00272835 predicted 6127
4 SASI_Mm01_00272836 predicted 6122
5 SASI_Mm01_00272837 predicted 6173
6 SASI_Mm01_00272838 predicted 6170
7 SASI_Mm01_00272839 predicted 6183
8 SASI_Mm01_00272840 predicted 6096
9 SASI_Mm01_00272841 predicted 6180
10 SASI_Mm01_00272842 predicted 6175
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277559 predicted 5405
2 SASI_Mm01_00277560 predicted 4408
3 SASI_Mm01_00277561 predicted 4345
4 SASI_Mm01_00277562 predicted 4446
5 SASI_Mm01_00277563 predicted 4406
6 SASI_Mm01_00277565 predicted 4378
7 SASI_Mm01_00277566 predicted 5431
8 SASI_Mm01_00277567 predicted 4378
9 SASI_Mm01_00277568 predicted 4443
10 SASI_Mm02_00355832 predicted 4415
11 SASI_Mm01_00277564 predicted 4340
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271758 predicted 5451
2 SASI_Mm01_00271759 predicted 4444
3 SASI_Mm01_00271760 predicted 4380
4 SASI_Mm01_00271761 predicted 4487
5 SASI_Mm01_00271762 predicted 4449
6 SASI_Mm01_00271763 predicted 4385
7 SASI_Mm01_00271764 predicted 4421
8 SASI_Mm01_00271765 predicted 5476
9 SASI_Mm01_00271766 predicted 4415
10 SASI_Mm01_00271767 predicted 4476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285662 predicted 5325
2 SASI_Mm01_00285663 predicted 4321
3 SASI_Mm01_00285664 predicted 4258
4 SASI_Mm01_00285665 predicted 4354
5 SASI_Mm01_00285666 predicted 4325
6 SASI_Mm01_00285667 predicted 4254
7 SASI_Mm01_00285668 predicted 4294
8 SASI_Mm01_00285669 predicted 5346
9 SASI_Mm01_00285670 predicted 4295
10 SASI_Mm01_00285671 predicted 4351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233231 predicted 2683
2 SASI_Mm01_00233232 predicted 2711
3 SASI_Mm01_00233233 predicted 2296
4 SASI_Mm01_00233234 predicted 2223
5 SASI_Mm01_00233235 predicted 2433
6 SASI_Mm01_00233236 predicted 1533
7 SASI_Mm01_00233237 predicted 1483
8 SASI_Mm01_00233238 predicted 1827
9 SASI_Mm01_00233239 predicted 1910
10 SASI_Mm01_00233240 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256896 predicted 2430
2 SASI_Mm01_00256897 predicted 1423
3 SASI_Mm01_00256898 predicted 1361
4 SASI_Mm01_00256899 predicted 1460
5 SASI_Mm01_00256900 predicted 1431
6 SASI_Mm01_00256901 predicted 1353
7 SASI_Mm01_00256902 predicted 1390
8 SASI_Mm01_00256903 predicted 2452
9 SASI_Mm01_00256904 predicted 1393
10 SASI_Mm01_00256905 predicted 1458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273841 predicted 5227
2 SASI_Mm01_00273842 predicted 4224
3 SASI_Mm01_00273843 predicted 4161
4 SASI_Mm01_00273844 predicted 4264
5 SASI_Mm01_00273845 predicted 4228
6 SASI_Mm01_00273846 predicted 4158
7 SASI_Mm01_00273847 predicted 4203
8 SASI_Mm01_00273848 predicted 5251
9 SASI_Mm01_00273849 predicted 4202
10 SASI_Mm01_00273850 predicted 4256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437208 predicted 5719
2 SASI_Mm02_00437209 predicted 5744
3 SASI_Mm02_00437210 predicted 990
4 SASI_Mm02_00437211 predicted 3189
5 SASI_Mm02_00437212 predicted 3206
6 SASI_Mm02_00437213 predicted 5260
7 SASI_Mm02_00437214 predicted 869
8 SASI_Mm02_00437215 predicted 4578
9 SASI_Mm02_00437216 predicted 1520
10 SASI_Mm02_00437217 predicted 2775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012401
VALIDATED
PLXNB2 MISSION shRNA Bacterial Glycerol Stock
plexin B2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012401.2-5512s21c1
Sequence:CCGGTGACGAGATCATCAATGCCTTCTCGAGAAGGCATTGATGATCTCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012401.2-5350s21c1
Sequence:CCGGCAAGAAGATGGTGGAGGATTACTCGAGTAATCCTCCACCATCTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_012401.2-5500s21c1
Sequence:CCGGGCAGAAGTACTATGACGAGATCTCGAGATCTCGTCATAGTACTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012401.2-6021s21c1
Sequence:GTACCGGGCAAGTTCCCAGATCCTATGTCTCGAGACATAGGATCTGGGAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_012401.2-5485s21c1
Sequence:CCGGGCTCTACCAATACACGCAGAACTCGAGTTCTGCGTGTATTGGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_012401.2-5785s21c1
Sequence:GTACCGGAGCATCTTCCTCTGAGCAATACTCGAGTATTGCTCAGAGGAAGATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012401
VALIDATED
PLXNB2 MISSION shRNA shRNA Plasmid DNA
plexin B2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012401.2-5512s21c1
Sequence:CCGGTGACGAGATCATCAATGCCTTCTCGAGAAGGCATTGATGATCTCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012401.2-5350s21c1
Sequence:CCGGCAAGAAGATGGTGGAGGATTACTCGAGTAATCCTCCACCATCTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_012401.2-5500s21c1
Sequence:CCGGGCAGAAGTACTATGACGAGATCTCGAGATCTCGTCATAGTACTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012401.2-6021s21c1
Sequence:GTACCGGGCAAGTTCCCAGATCCTATGTCTCGAGACATAGGATCTGGGAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_012401.2-5485s21c1
Sequence:CCGGGCTCTACCAATACACGCAGAACTCGAGTTCTGCGTGTATTGGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_012401.2-5785s21c1
Sequence:GTACCGGAGCATCTTCCTCTGAGCAATACTCGAGTATTGCTCAGAGGAAGATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012401
VALIDATED
PLXNB2 MISSION shRNA Lentiviral Transduction Particles
plexin B2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012401.2-5512s21c1
Sequence:CCGGTGACGAGATCATCAATGCCTTCTCGAGAAGGCATTGATGATCTCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012401.2-5350s21c1
Sequence:CCGGCAAGAAGATGGTGGAGGATTACTCGAGTAATCCTCCACCATCTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_012401.2-5500s21c1
Sequence:CCGGGCAGAAGTACTATGACGAGATCTCGAGATCTCGTCATAGTACTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012401.2-6021s21c1
Sequence:GTACCGGGCAAGTTCCCAGATCCTATGTCTCGAGACATAGGATCTGGGAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_012401.2-5485s21c1
Sequence:CCGGGCTCTACCAATACACGCAGAACTCGAGTTCTGCGTGTATTGGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_012401.2-5785s21c1
Sequence:GTACCGGAGCATCTTCCTCTGAGCAATACTCGAGTATTGCTCAGAGGAAGATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371474
VALIDATED
PLXNB2 MISSION shRNA Bacterial Glycerol Stock
plexin B2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_371474.1-216s1c1
Sequence:CCGGTGACGAGATCATCAATGCCTTCTCGAGAAGGCATTGATGATCTCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371474.1-189s1c1
Sequence:CCGGGCTCTACCAATACACGCAGAACTCGAGTTCTGCGTGTATTGGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_371474.1-300s1c1
Sequence:CCGGACTGGAGAACAAGGTCACTGACTCGAGTCAGTGACCTTGTTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_371474.1-54s1c1
Sequence:CCGGCAAGAAGATGGTGGAGGATTACTCGAGTAATCCTCCACCATCTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_371474.1-204s1c1
Sequence:CCGGGCAGAAGTACTATGACGAGATCTCGAGATCTCGTCATAGTACTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371474
VALIDATED
PLXNB2 MISSION shRNA shRNA Plasmid DNA
plexin B2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_371474.1-216s1c1
Sequence:CCGGTGACGAGATCATCAATGCCTTCTCGAGAAGGCATTGATGATCTCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371474.1-189s1c1
Sequence:CCGGGCTCTACCAATACACGCAGAACTCGAGTTCTGCGTGTATTGGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_371474.1-300s1c1
Sequence:CCGGACTGGAGAACAAGGTCACTGACTCGAGTCAGTGACCTTGTTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_371474.1-54s1c1
Sequence:CCGGCAAGAAGATGGTGGAGGATTACTCGAGTAATCCTCCACCATCTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_371474.1-204s1c1
Sequence:CCGGGCAGAAGTACTATGACGAGATCTCGAGATCTCGTCATAGTACTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371474
VALIDATED
PLXNB2 MISSION shRNA Lentiviral Transduction Particles
plexin B2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_371474.1-216s1c1
Sequence:CCGGTGACGAGATCATCAATGCCTTCTCGAGAAGGCATTGATGATCTCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371474.1-189s1c1
Sequence:CCGGGCTCTACCAATACACGCAGAACTCGAGTTCTGCGTGTATTGGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_371474.1-300s1c1
Sequence:CCGGACTGGAGAACAAGGTCACTGACTCGAGTCAGTGACCTTGTTCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_371474.1-54s1c1
Sequence:CCGGCAAGAAGATGGTGGAGGATTACTCGAGTAATCCTCCACCATCTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_371474.1-204s1c1
Sequence:CCGGGCAGAAGTACTATGACGAGATCTCGAGATCTCGTCATAGTACTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484491
VALIDATED
PLXNB2 MISSION shRNA Bacterial Glycerol Stock
plexin B2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484491.2-5953s1c1
Sequence:CCGGGCGTCTTTCTCCTGAGCAATACTCGAGTATTGCTCAGGAGAAAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484491.2-5477s1c1
Sequence:CCGGCCCAGCAACAAGCTGTTGTATCTCGAGATACAACAGCTTGTTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_484491.2-4237s1c1
Sequence:CCGGCCTGCTTAATAGCAAGTCCTTCTCGAGAAGGACTTGCTATTAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_484491.2-5573s1c1
Sequence:CCGGCCAGGACATGAATACGCACTTCTCGAGAAGTGCGTATTCATGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_484491.2-1565s1c1
Sequence:CCGGCCAGTAGACATCAATAAGAAACTCGAGTTTCTTATTGATGTCTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484491
VALIDATED
PLXNB2 MISSION shRNA shRNA Plasmid DNA
plexin B2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484491.2-5953s1c1
Sequence:CCGGGCGTCTTTCTCCTGAGCAATACTCGAGTATTGCTCAGGAGAAAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484491.2-5477s1c1
Sequence:CCGGCCCAGCAACAAGCTGTTGTATCTCGAGATACAACAGCTTGTTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_484491.2-4237s1c1
Sequence:CCGGCCTGCTTAATAGCAAGTCCTTCTCGAGAAGGACTTGCTATTAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_484491.2-5573s1c1
Sequence:CCGGCCAGGACATGAATACGCACTTCTCGAGAAGTGCGTATTCATGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_484491.2-1565s1c1
Sequence:CCGGCCAGTAGACATCAATAAGAAACTCGAGTTTCTTATTGATGTCTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484491
VALIDATED
PLXNB2 MISSION shRNA Lentiviral Transduction Particles
plexin B2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484491.2-5953s1c1
Sequence:CCGGGCGTCTTTCTCCTGAGCAATACTCGAGTATTGCTCAGGAGAAAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484491.2-5477s1c1
Sequence:CCGGCCCAGCAACAAGCTGTTGTATCTCGAGATACAACAGCTTGTTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_484491.2-4237s1c1
Sequence:CCGGCCTGCTTAATAGCAAGTCCTTCTCGAGAAGGACTTGCTATTAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_484491.2-5573s1c1
Sequence:CCGGCCAGGACATGAATACGCACTTCTCGAGAAGTGCGTATTCATGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_484491.2-1565s1c1
Sequence:CCGGCCAGTAGACATCAATAAGAAACTCGAGTTTCTTATTGATGTCTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)