EMAIL THIS PAGE TO A FRIEND

PLXNB3

plexin B3

88 Gene Product Result for
Synonyms: PLEXB3 PLEXR PLXN6
UniProtKB ID: Q9ULL4, B7Z3E6, F5H773, Q9HDA4
Gene ID:
Human(5365) Summary: The protein encoded by this gene is a member of the plexin family. It functions as a receptor for semaphorin 5A, and plays a role in axon guidance, invasive growth and cell migration. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(140571) plexin B3
Rat(363517) plexin B3
Zebrafish(566546) plexin B3
Horse(100058942) plexin B3
dog(492243) plexin B3
cow(504294) plexin B3
sheep(101122420) plexin B3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005393 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019587 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019587 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019587 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005393 Rosetta Predictions human pricing
XM_001057493 Rosetta Predictions rat pricing
XM_343841 Rosetta Predictions rat pricing
NM_019587 Rosetta Predictions mouse pricing
XM_621027 Rosetta Predictions mouse pricing
XM_891179 Rosetta Predictions mouse pricing
XM_899452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134446 predicted 305
2 SASI_Hs01_00134447 predicted 1874
3 SASI_Hs01_00134448 predicted 4399
4 SASI_Hs01_00134449 predicted 594
5 SASI_Hs01_00134451 predicted 251
6 SASI_Hs01_00134452 predicted 2436
7 SASI_Hs01_00134453 predicted 5424
8 SASI_Hs01_00134454 predicted 2203
9 SASI_Hs01_00134455 predicted 5629
10 SASI_Hs02_00339521 predicted 3929
11 SASI_Hs01_00134450 predicted 5725
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286567 predicted 1663
2 SASI_Rn02_00286568 predicted 1222
3 SASI_Rn02_00286569 predicted 5588
4 SASI_Rn02_00286570 predicted 2547
5 SASI_Rn02_00286571 predicted 244
6 SASI_Rn02_00286572 predicted 1829
7 SASI_Rn02_00286573 predicted 3967
8 SASI_Rn02_00286574 predicted 5698
9 SASI_Rn02_00286575 predicted 2461
10 SASI_Rn02_00286576 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343841 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396417 predicted 1661
2 SASI_Rn02_00396418 predicted 1227
3 SASI_Rn02_00396419 predicted 5586
4 SASI_Rn02_00396420 predicted 2547
5 SASI_Rn02_00396421 predicted 238
6 SASI_Rn02_00396422 predicted 1830
7 SASI_Rn02_00396423 predicted 3971
8 SASI_Rn02_00396424 predicted 5698
9 SASI_Rn02_00396425 predicted 2459
10 SASI_Rn02_00396426 predicted 1799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324650 predicted 4398
2 SASI_Mm02_00324651 predicted 910
3 SASI_Mm02_00324652 predicted 2600
4 SASI_Mm02_00324653 predicted 201
5 SASI_Mm02_00324654 predicted 3001
6 SASI_Mm02_00324655 predicted 1230
7 SASI_Mm02_00324656 predicted 222
8 SASI_Mm02_00324657 predicted 2336
9 SASI_Mm02_00324658 predicted 697
10 SASI_Mm02_00324659 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_621027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263894 predicted 1624
2 SASI_Mm01_00263895 predicted 819
3 SASI_Mm01_00263896 predicted 1006
4 SASI_Mm01_00263897 predicted 1989
5 SASI_Mm01_00263898 predicted 729
6 SASI_Mm01_00263899 predicted 2068
7 SASI_Mm01_00263900 predicted 1927
8 SASI_Mm01_00263901 predicted 800
9 SASI_Mm01_00263902 predicted 1315
10 SASI_Mm01_00263903 predicted 1908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215250 predicted 4407
2 SASI_Mm01_00215251 predicted 5567
3 SASI_Mm01_00215252 predicted 917
4 SASI_Mm01_00215253 predicted 2608
5 SASI_Mm01_00215254 predicted 207
6 SASI_Mm01_00215255 predicted 2998
7 SASI_Mm01_00215256 predicted 1230
8 SASI_Mm01_00215257 predicted 229
9 SASI_Mm01_00215258 predicted 2341
10 SASI_Mm01_00215259 predicted 4398
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276175 predicted 3411
2 SASI_Mm01_00276176 predicted 2954
3 SASI_Mm01_00276177 predicted 4578
4 SASI_Mm01_00276178 predicted 3839
5 SASI_Mm01_00276179 predicted 4382
6 SASI_Mm01_00276180 predicted 4108
7 SASI_Mm01_00276181 predicted 3397
8 SASI_Mm01_00276182 predicted 4113
9 SASI_Mm01_00276183 predicted 4205
10 SASI_Mm01_00276184 predicted 3187
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005393
PLXNB3 MISSION shRNA Bacterial Glycerol Stock
plexin B3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005393.2-308s21c1
Sequence:CCGGATCGCTTCTCCGCACCTAATACTCGAGTATTAGGTGCGGAGAAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005393.2-5554s21c1
Sequence:CCGGTGTACCACCTCGGAGCATAAACTCGAGTTTATGCTCCGAGGTGGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005393.2-5645s21c1
Sequence:CCGGAGAGGTACTATGCGGACATTCCTCGAGGAATGTCCGCATAGTACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-258s1c1
Sequence:CCGGCGCACCTAATACCACTCTCAACTCGAGTTGAGAGTGGTATTAGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-5529s1c1
Sequence:CCGGCCCAGTGAACAAACTGCTCTACTCGAGTAGAGCAGTTTGTTCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-5413s1c1
Sequence:CCGGCCACAGCTCATCTTTGATGTACTCGAGTACATCAAAGATGAGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-5628s1c1
Sequence:CCGGCCAGGAGATGAACTCTGCTTTCTCGAGAAAGCAGAGTTCATCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-798s1c1
Sequence:CCGGCGACTACAACAACAGCTACGTCTCGAGACGTAGCTGTTGTTGTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005393
PLXNB3 MISSION shRNA shRNA Plasmid DNA
plexin B3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005393.2-308s21c1
Sequence:CCGGATCGCTTCTCCGCACCTAATACTCGAGTATTAGGTGCGGAGAAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005393.2-5554s21c1
Sequence:CCGGTGTACCACCTCGGAGCATAAACTCGAGTTTATGCTCCGAGGTGGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005393.2-5645s21c1
Sequence:CCGGAGAGGTACTATGCGGACATTCCTCGAGGAATGTCCGCATAGTACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-258s1c1
Sequence:CCGGCGCACCTAATACCACTCTCAACTCGAGTTGAGAGTGGTATTAGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-5529s1c1
Sequence:CCGGCCCAGTGAACAAACTGCTCTACTCGAGTAGAGCAGTTTGTTCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-5413s1c1
Sequence:CCGGCCACAGCTCATCTTTGATGTACTCGAGTACATCAAAGATGAGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-5628s1c1
Sequence:CCGGCCAGGAGATGAACTCTGCTTTCTCGAGAAAGCAGAGTTCATCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-798s1c1
Sequence:CCGGCGACTACAACAACAGCTACGTCTCGAGACGTAGCTGTTGTTGTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005393
PLXNB3 MISSION shRNA Lentiviral Transduction Particles
plexin B3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005393.2-308s21c1
Sequence:CCGGATCGCTTCTCCGCACCTAATACTCGAGTATTAGGTGCGGAGAAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005393.2-5554s21c1
Sequence:CCGGTGTACCACCTCGGAGCATAAACTCGAGTTTATGCTCCGAGGTGGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005393.2-5645s21c1
Sequence:CCGGAGAGGTACTATGCGGACATTCCTCGAGGAATGTCCGCATAGTACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-258s1c1
Sequence:CCGGCGCACCTAATACCACTCTCAACTCGAGTTGAGAGTGGTATTAGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-5529s1c1
Sequence:CCGGCCCAGTGAACAAACTGCTCTACTCGAGTAGAGCAGTTTGTTCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-5413s1c1
Sequence:CCGGCCACAGCTCATCTTTGATGTACTCGAGTACATCAAAGATGAGCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-5628s1c1
Sequence:CCGGCCAGGAGATGAACTCTGCTTTCTCGAGAAAGCAGAGTTCATCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005393.1-798s1c1
Sequence:CCGGCGACTACAACAACAGCTACGTCTCGAGACGTAGCTGTTGTTGTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019587
PLXNB3 MISSION shRNA Bacterial Glycerol Stock
plexin B3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019587.2-5630s21c1
Sequence:CCGGCAACCACATCCACAGGTATTACTCGAGTAATACCTGTGGATGTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019587.2-5782s21c1
Sequence:CCGGCCTGAGACCTGCCAACTTATACTCGAGTATAAGTTGGCAGGTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019587.2-5105s1c1
Sequence:CCGGCTATCTTACTCGCTTACTTTCCTCGAGGAAAGTAAGCGAGTAAGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019587.2-1083s21c1
Sequence:CCGGACATCCCGTTGCGTCACTTTGCTCGAGCAAAGTGACGCAACGGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019587.2-5503s21c1
Sequence:CCGGAGAAGTACTATGCGGACATTCCTCGAGGAATGTCCGCATAGTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019587.2-5199s21c1
Sequence:CCGGATTGCTGTTAAGTACCTATTTCTCGAGAAATAGGTACTTAACAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019587.1-5711s1c1
Sequence:CCGGCCTGAGACCTGCCAACTTATACTCGAGTATAAGTTGGCAGGTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019587
PLXNB3 MISSION shRNA shRNA Plasmid DNA
plexin B3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019587.2-5630s21c1
Sequence:CCGGCAACCACATCCACAGGTATTACTCGAGTAATACCTGTGGATGTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019587.2-5782s21c1
Sequence:CCGGCCTGAGACCTGCCAACTTATACTCGAGTATAAGTTGGCAGGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019587.2-5105s1c1
Sequence:CCGGCTATCTTACTCGCTTACTTTCCTCGAGGAAAGTAAGCGAGTAAGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019587.2-1083s21c1
Sequence:CCGGACATCCCGTTGCGTCACTTTGCTCGAGCAAAGTGACGCAACGGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019587.2-5503s21c1
Sequence:CCGGAGAAGTACTATGCGGACATTCCTCGAGGAATGTCCGCATAGTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019587.2-5199s21c1
Sequence:CCGGATTGCTGTTAAGTACCTATTTCTCGAGAAATAGGTACTTAACAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019587.1-5711s1c1
Sequence:CCGGCCTGAGACCTGCCAACTTATACTCGAGTATAAGTTGGCAGGTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019587
PLXNB3 MISSION shRNA Lentiviral Transduction Particles
plexin B3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019587.2-5630s21c1
Sequence:CCGGCAACCACATCCACAGGTATTACTCGAGTAATACCTGTGGATGTGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019587.2-5782s21c1
Sequence:CCGGCCTGAGACCTGCCAACTTATACTCGAGTATAAGTTGGCAGGTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019587.2-5105s1c1
Sequence:CCGGCTATCTTACTCGCTTACTTTCCTCGAGGAAAGTAAGCGAGTAAGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019587.2-1083s21c1
Sequence:CCGGACATCCCGTTGCGTCACTTTGCTCGAGCAAAGTGACGCAACGGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019587.2-5503s21c1
Sequence:CCGGAGAAGTACTATGCGGACATTCCTCGAGGAATGTCCGCATAGTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019587.2-5199s21c1
Sequence:CCGGATTGCTGTTAAGTACCTATTTCTCGAGAAATAGGTACTTAACAGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019587.1-5711s1c1
Sequence:CCGGCCTGAGACCTGCCAACTTATACTCGAGTATAAGTTGGCAGGTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)