EMAIL THIS PAGE TO A FRIEND

PLXND1

plexin D1

71 Gene Product Result for
Synonyms: PLEXD1
UniProtKB ID: Q9Y4D7, A7E2C6, C9JPZ6, Q6PJS9, Q8IZJ2, Q9BTQ2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015103 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_149784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_149784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_149784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_026376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155221 MISSION® esiRNA esiRNA human PLXND1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015103 Rosetta Predictions human pricing
NM_001107881 Rosetta Predictions rat pricing
NM_026376 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194034 predicted 5257
2 SASI_Hs01_00194035 predicted 4057
3 SASI_Hs02_00346991 predicted 1844
4 SASI_Hs01_00194037 predicted 4394
5 SASI_Hs01_00194038 predicted 2179
6 SASI_Hs01_00194039 predicted 5708
7 SASI_Hs01_00194041 predicted 4187
8 SASI_Hs01_00194042 predicted 5574
9 SASI_Hs02_00346992 predicted 5103
10 SASI_Hs02_00346993 predicted 2915
11 SASI_Hs01_00194033 predicted 4744
12 SASI_Hs01_00194036 predicted 5768
13 SASI_Hs01_00194040 predicted 1755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233195 predicted 1258
2 SASI_Rn02_00233196 predicted 3920
3 SASI_Rn02_00233197 predicted 3647
4 SASI_Rn02_00233198 predicted 1402
5 SASI_Rn02_00233199 predicted 3160
6 SASI_Rn02_00233200 predicted 1713
7 SASI_Rn02_00233201 predicted 1905
8 SASI_Rn02_00233202 predicted 1882
9 SASI_Rn02_00233203 predicted 2994
10 SASI_Rn02_00233204 predicted 4964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170316 predicted 5282
2 SASI_Mm01_00170317 predicted 1641
3 SASI_Mm01_00170318 predicted 1782
4 SASI_Mm01_00170319 predicted 4304
5 SASI_Mm02_00330109 predicted 5791
6 SASI_Mm01_00170321 predicted 2588
7 SASI_Mm02_00330110 predicted 5825
8 SASI_Mm02_00330111 predicted 5777
9 SASI_Mm01_00170322 predicted 4009
10 SASI_Mm01_00170323 predicted 3380
11 SASI_Mm01_00170320 predicted 3516
12 SASI_Mm01_00170324 predicted 3602
13 SASI_Mm01_00170325 predicted 2251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015103
VALIDATED
PLXND1 MISSION shRNA Bacterial Glycerol Stock
plexin D1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015103.2-4182s21c1
Sequence:GTACCGGCCAAGTGTTCCTCCCTTTATGCTCGAGCATAAAGGGAGGAACACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015103.1-4271s1c1
Sequence:CCGGCCTCCCTTTATGAAGAGCGTTCTCGAGAACGCTCTTCATAAAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015103.1-537s1c1
Sequence:CCGGCCTCACGGACAACTACAACAACTCGAGTTGTTGTAGTTGTCCGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015103.1-4749s1c1
Sequence:CCGGGCAAATCAACAAGGGCTCCATCTCGAGATGGAGCCCTTGTTGATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015103.1-5098s1c1
Sequence:CCGGGCCCATTACAAGATCCCTGAACTCGAGTTCAGGGATCTTGTAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015103.1-1659s1c1
Sequence:CCGGGCTTCTCAAGATCAACCTGAACTCGAGTTCAGGTTGATCTTGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015103.2-2170s21c1
Sequence:GTACCGGGAACATCGTCAAGGCCAATTTCTCGAGAAATTGGCCTTGACGATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015103.2-5802s21c1
Sequence:CCGGCACAACTGCAGCACAAGTTTGCTCGAGCAAACTTGTGCTGCAGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015103.2-1579s21c1
Sequence:CCGGGCTTCTCAAGATCAACCTGAACTCGAGTTCAGGTTGATCTTGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015103.2-5185s21c1
Sequence:CCGGCAAGAAGGTGCTCCCGGAAATCTCGAGATTTCCGGGAGCACCTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015103.2-2624s21c1
Sequence:CCGGATGACAGTCATGGTCTATAACCTCGAGGTTATAGACCATGACTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015103.2-5959s21c1
Sequence:CCGGTGTGACTCAGACTGGGAAATACTCGAGTATTTCCCAGTCTGAGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015103
VALIDATED
PLXND1 MISSION shRNA shRNA Plasmid DNA
plexin D1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015103.2-4182s21c1
Sequence:GTACCGGCCAAGTGTTCCTCCCTTTATGCTCGAGCATAAAGGGAGGAACACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015103.1-4271s1c1
Sequence:CCGGCCTCCCTTTATGAAGAGCGTTCTCGAGAACGCTCTTCATAAAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015103.1-537s1c1
Sequence:CCGGCCTCACGGACAACTACAACAACTCGAGTTGTTGTAGTTGTCCGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015103.1-4749s1c1
Sequence:CCGGGCAAATCAACAAGGGCTCCATCTCGAGATGGAGCCCTTGTTGATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015103.1-5098s1c1
Sequence:CCGGGCCCATTACAAGATCCCTGAACTCGAGTTCAGGGATCTTGTAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015103.1-1659s1c1
Sequence:CCGGGCTTCTCAAGATCAACCTGAACTCGAGTTCAGGTTGATCTTGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015103.2-2170s21c1
Sequence:GTACCGGGAACATCGTCAAGGCCAATTTCTCGAGAAATTGGCCTTGACGATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015103.2-5802s21c1
Sequence:CCGGCACAACTGCAGCACAAGTTTGCTCGAGCAAACTTGTGCTGCAGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015103.2-1579s21c1
Sequence:CCGGGCTTCTCAAGATCAACCTGAACTCGAGTTCAGGTTGATCTTGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015103.2-5185s21c1
Sequence:CCGGCAAGAAGGTGCTCCCGGAAATCTCGAGATTTCCGGGAGCACCTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015103.2-2624s21c1
Sequence:CCGGATGACAGTCATGGTCTATAACCTCGAGGTTATAGACCATGACTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015103.2-5959s21c1
Sequence:CCGGTGTGACTCAGACTGGGAAATACTCGAGTATTTCCCAGTCTGAGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015103
VALIDATED
PLXND1 MISSION shRNA Lentiviral Transduction Particles
plexin D1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015103.2-4182s21c1
Sequence:GTACCGGCCAAGTGTTCCTCCCTTTATGCTCGAGCATAAAGGGAGGAACACTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015103.1-4271s1c1
Sequence:CCGGCCTCCCTTTATGAAGAGCGTTCTCGAGAACGCTCTTCATAAAGGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015103.1-537s1c1
Sequence:CCGGCCTCACGGACAACTACAACAACTCGAGTTGTTGTAGTTGTCCGTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015103.1-4749s1c1
Sequence:CCGGGCAAATCAACAAGGGCTCCATCTCGAGATGGAGCCCTTGTTGATTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015103.1-5098s1c1
Sequence:CCGGGCCCATTACAAGATCCCTGAACTCGAGTTCAGGGATCTTGTAATGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015103.1-1659s1c1
Sequence:CCGGGCTTCTCAAGATCAACCTGAACTCGAGTTCAGGTTGATCTTGAGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015103.2-2170s21c1
Sequence:GTACCGGGAACATCGTCAAGGCCAATTTCTCGAGAAATTGGCCTTGACGATGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015103.2-5802s21c1
Sequence:CCGGCACAACTGCAGCACAAGTTTGCTCGAGCAAACTTGTGCTGCAGTTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015103.2-1579s21c1
Sequence:CCGGGCTTCTCAAGATCAACCTGAACTCGAGTTCAGGTTGATCTTGAGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015103.2-5185s21c1
Sequence:CCGGCAAGAAGGTGCTCCCGGAAATCTCGAGATTTCCGGGAGCACCTTCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015103.2-2624s21c1
Sequence:CCGGATGACAGTCATGGTCTATAACCTCGAGGTTATAGACCATGACTGTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015103.2-5959s21c1
Sequence:CCGGTGTGACTCAGACTGGGAAATACTCGAGTATTTCCCAGTCTGAGTCACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_149784
VALIDATED
PLXND1 MISSION shRNA Bacterial Glycerol Stock
plexin D1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_149784.4-5824s1c1
Sequence:CCGGGCCAGTCCCTAATAAGACTTTCTCGAGAAAGTCTTATTAGGGACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149784.4-897s1c1
Sequence:CCGGCGAGCAGTTCTTCGCTGTCTTCTCGAGAAGACAGCGAAGAACTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_149784.4-3208s1c1
Sequence:CCGGCCTGTAGACTTCTTCATCAATCTCGAGATTGATGAAGAAGTCTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_149784.4-2557s1c1
Sequence:CCGGCGGCTCAGTGATGTGGCACATCTCGAGATGTGCCACATCACTGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_149784.4-4461s1c1
Sequence:CCGGCCGGAACTTGAACGTGTCCTTCTCGAGAAGGACACGTTCAAGTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_149784
VALIDATED
PLXND1 MISSION shRNA shRNA Plasmid DNA
plexin D1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_149784.4-5824s1c1
Sequence:CCGGGCCAGTCCCTAATAAGACTTTCTCGAGAAAGTCTTATTAGGGACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149784.4-897s1c1
Sequence:CCGGCGAGCAGTTCTTCGCTGTCTTCTCGAGAAGACAGCGAAGAACTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_149784.4-3208s1c1
Sequence:CCGGCCTGTAGACTTCTTCATCAATCTCGAGATTGATGAAGAAGTCTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_149784.4-2557s1c1
Sequence:CCGGCGGCTCAGTGATGTGGCACATCTCGAGATGTGCCACATCACTGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_149784.4-4461s1c1
Sequence:CCGGCCGGAACTTGAACGTGTCCTTCTCGAGAAGGACACGTTCAAGTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_149784
VALIDATED
PLXND1 MISSION shRNA Lentiviral Transduction Particles
plexin D1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_149784.4-5824s1c1
Sequence:CCGGGCCAGTCCCTAATAAGACTTTCTCGAGAAAGTCTTATTAGGGACTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149784.4-897s1c1
Sequence:CCGGCGAGCAGTTCTTCGCTGTCTTCTCGAGAAGACAGCGAAGAACTGCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_149784.4-3208s1c1
Sequence:CCGGCCTGTAGACTTCTTCATCAATCTCGAGATTGATGAAGAAGTCTACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_149784.4-2557s1c1
Sequence:CCGGCGGCTCAGTGATGTGGCACATCTCGAGATGTGCCACATCACTGAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_149784.4-4461s1c1
Sequence:CCGGCCGGAACTTGAACGTGTCCTTCTCGAGAAGGACACGTTCAAGTTCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026376
VALIDATED
PLXND1 MISSION shRNA Bacterial Glycerol Stock
plexin D1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-4558s21c1
Sequence:CCGGACGGCAAGCTGGAGTACTATACTCGAGTATAGTACTCCAGCTTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-2302s21c1
Sequence:CCGGTCTACGACTGCAGCCGAATTGCTCGAGCAATTCGGCTGCAGTCGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-5699s21c1
Sequence:CCGGGACCGTACAGCGCTATTATAACTCGAGTTATAATAGCGCTGTACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-6222s21c1
Sequence:CCGGATCGCTGCCAGTCCCTAATAACTCGAGTTATTAGGGACTGGCAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-2961s21c1
Sequence:CCGGCGGCTCAGTGATGTGGCACATCTCGAGATGTGCCACATCACTGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026376
VALIDATED
PLXND1 MISSION shRNA shRNA Plasmid DNA
plexin D1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-4558s21c1
Sequence:CCGGACGGCAAGCTGGAGTACTATACTCGAGTATAGTACTCCAGCTTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-2302s21c1
Sequence:CCGGTCTACGACTGCAGCCGAATTGCTCGAGCAATTCGGCTGCAGTCGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-5699s21c1
Sequence:CCGGGACCGTACAGCGCTATTATAACTCGAGTTATAATAGCGCTGTACGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-6222s21c1
Sequence:CCGGATCGCTGCCAGTCCCTAATAACTCGAGTTATTAGGGACTGGCAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-2961s21c1
Sequence:CCGGCGGCTCAGTGATGTGGCACATCTCGAGATGTGCCACATCACTGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026376
VALIDATED
PLXND1 MISSION shRNA Lentiviral Transduction Particles
plexin D1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-4558s21c1
Sequence:CCGGACGGCAAGCTGGAGTACTATACTCGAGTATAGTACTCCAGCTTGCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-2302s21c1
Sequence:CCGGTCTACGACTGCAGCCGAATTGCTCGAGCAATTCGGCTGCAGTCGTAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-5699s21c1
Sequence:CCGGGACCGTACAGCGCTATTATAACTCGAGTTATAATAGCGCTGTACGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-6222s21c1
Sequence:CCGGATCGCTGCCAGTCCCTAATAACTCGAGTTATTAGGGACTGGCAGCGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026376.3-2961s21c1
Sequence:CCGGCGGCTCAGTGATGTGGCACATCTCGAGATGTGCCACATCACTGAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)