EMAIL THIS PAGE TO A FRIEND

PM20D2

peptidase M20 domain containing 2

77 Gene Product Result for
Synonyms: ACY1L2 bA63L7.3
UniProtKB ID: Q8IYS1, B4DYJ2, Q5T7J9, Q6MZV2, Q86XD9
Gene ID:
Mouse(242377) peptidase M20 domain containing 2
Rat(313130) peptidase M20 domain containing 2
chicken(421816) peptidase M20 domain containing 2
domestic cat(101092939) peptidase M20 domain containing 2
dog(481916) peptidase M20 domain containing 2
domestic guinea pig(100733873) peptidase M20 domain containing 2
naked mole-rat(101725857) peptidase M20 domain containing 2
Domestic Rabbit(100340757) peptidase M20 domain containing 2
cow(521179) peptidase M20 domain containing 2
sheep(101111105) peptidase M20 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010853 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001034867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010853 Rosetta Predictions human pricing
NM_001107922 Rosetta Predictions rat pricing
NM_001034867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077878 predicted 876
2 SASI_Hs01_00077879 predicted 1229
3 SASI_Hs01_00077880 predicted 1322
4 SASI_Hs01_00077881 predicted 872
5 SASI_Hs01_00077882 predicted 1045
6 SASI_Hs01_00077884 predicted 1211
7 SASI_Hs01_00077885 predicted 1089
8 SASI_Hs01_00077886 predicted 1041
9 SASI_Hs01_00077887 predicted 698
10 SASI_Hs02_00305792 predicted 1087
11 SASI_Hs01_00077883 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233605 predicted 216
2 SASI_Rn02_00233606 predicted 247
3 SASI_Rn02_00233607 predicted 276
4 SASI_Rn02_00233608 predicted 256
5 SASI_Rn02_00233609 predicted 363
6 SASI_Rn02_00233610 predicted 240
7 SASI_Rn02_00233611 predicted 220
8 SASI_Rn02_00233612 predicted 259
9 SASI_Rn02_00233613 predicted 226
10 SASI_Rn02_00233614 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131362 predicted 721
2 SASI_Mm01_00131363 predicted 796
3 SASI_Mm01_00131364 predicted 1119
4 SASI_Mm01_00131365 predicted 991
5 SASI_Mm01_00131366 predicted 1083
6 SASI_Mm01_00131367 predicted 1119
7 SASI_Mm01_00131368 predicted 1056
8 SASI_Mm01_00131369 predicted 1055
9 SASI_Mm01_00131370 predicted 1046
10 SASI_Mm01_00131371 predicted 943
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010853
VALIDATED
PM20D2 MISSION shRNA Bacterial Glycerol Stock
peptidase M20 domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010853.1-880s21c1
Sequence:CCGGCCAATATCATTCCCTCTTATTCTCGAGAATAAGAGGGAATGATATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010853.1-1788s21c1
Sequence:CCGGGAGATTTCAAACCTTATATTCCTCGAGGAATATAAGGTTTGAAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010853.1-1208s21c1
Sequence:CCGGATCTAATGCCTTGAATCATACCTCGAGGTATGATTCAAGGCATTAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010853.1-1059s21c1
Sequence:CCGGAGCCTATGGAAAGCCTATATGCTCGAGCATATAGGCTTTCCATAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010853.1-1373s21c1
Sequence:CCGGTCAAGAAGAACAGTTTGTAAACTCGAGTTTACAAACTGTTCTTCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010853.1-1589s21c1
Sequence:CCGGATCCGTACTTGATAGGATTATCTCGAGATAATCCTATCAAGTACGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010853.1-809s1c1
Sequence:CCGGGTCTGTGTTCAGACAGCAAATCTCGAGATTTGCTGTCTGAACACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010853.1-690s1c1
Sequence:CCGGCCAGATATGGCTGAACATGATCTCGAGATCATGTTCAGCCATATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010853.1-4407s1c1
Sequence:CCGGCCCTACACAATACTAACCTTTCTCGAGAAAGGTTAGTATTGTGTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010853.1-1011s1c1
Sequence:CCGGGAAATTAAAGGTGGAGCACATCTCGAGATGTGCTCCACCTTTAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010853
VALIDATED
PM20D2 MISSION shRNA shRNA Plasmid DNA
peptidase M20 domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010853.1-880s21c1
Sequence:CCGGCCAATATCATTCCCTCTTATTCTCGAGAATAAGAGGGAATGATATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010853.1-1788s21c1
Sequence:CCGGGAGATTTCAAACCTTATATTCCTCGAGGAATATAAGGTTTGAAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010853.1-1208s21c1
Sequence:CCGGATCTAATGCCTTGAATCATACCTCGAGGTATGATTCAAGGCATTAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010853.1-1059s21c1
Sequence:CCGGAGCCTATGGAAAGCCTATATGCTCGAGCATATAGGCTTTCCATAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010853.1-1373s21c1
Sequence:CCGGTCAAGAAGAACAGTTTGTAAACTCGAGTTTACAAACTGTTCTTCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010853.1-1589s21c1
Sequence:CCGGATCCGTACTTGATAGGATTATCTCGAGATAATCCTATCAAGTACGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010853.1-809s1c1
Sequence:CCGGGTCTGTGTTCAGACAGCAAATCTCGAGATTTGCTGTCTGAACACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010853.1-690s1c1
Sequence:CCGGCCAGATATGGCTGAACATGATCTCGAGATCATGTTCAGCCATATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010853.1-4407s1c1
Sequence:CCGGCCCTACACAATACTAACCTTTCTCGAGAAAGGTTAGTATTGTGTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010853.1-1011s1c1
Sequence:CCGGGAAATTAAAGGTGGAGCACATCTCGAGATGTGCTCCACCTTTAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010853
VALIDATED
PM20D2 MISSION shRNA Lentiviral Transduction Particles
peptidase M20 domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010853.1-880s21c1
Sequence:CCGGCCAATATCATTCCCTCTTATTCTCGAGAATAAGAGGGAATGATATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010853.1-1788s21c1
Sequence:CCGGGAGATTTCAAACCTTATATTCCTCGAGGAATATAAGGTTTGAAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010853.1-1208s21c1
Sequence:CCGGATCTAATGCCTTGAATCATACCTCGAGGTATGATTCAAGGCATTAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010853.1-1059s21c1
Sequence:CCGGAGCCTATGGAAAGCCTATATGCTCGAGCATATAGGCTTTCCATAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010853.1-1373s21c1
Sequence:CCGGTCAAGAAGAACAGTTTGTAAACTCGAGTTTACAAACTGTTCTTCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010853.1-1589s21c1
Sequence:CCGGATCCGTACTTGATAGGATTATCTCGAGATAATCCTATCAAGTACGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010853.1-809s1c1
Sequence:CCGGGTCTGTGTTCAGACAGCAAATCTCGAGATTTGCTGTCTGAACACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010853.1-690s1c1
Sequence:CCGGCCAGATATGGCTGAACATGATCTCGAGATCATGTTCAGCCATATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010853.1-4407s1c1
Sequence:CCGGCCCTACACAATACTAACCTTTCTCGAGAAAGGTTAGTATTGTGTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010853.1-1011s1c1
Sequence:CCGGGAAATTAAAGGTGGAGCACATCTCGAGATGTGCTCCACCTTTAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034867
PM20D2 MISSION shRNA Bacterial Glycerol Stock
peptidase M20 domain containing 2
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000202116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034867.1-1039s1c1
Sequence:CCGGCTTGCCTATACCAACCTCTCTCTCGAGAGAGAGGTTGGTATAGGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034867.1-1186s1c1
Sequence:CCGGGAGCTTCAAGTTCTGACCAAACTCGAGTTTGGTCAGAACTTGAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034867
PM20D2 MISSION shRNA shRNA Plasmid DNA
peptidase M20 domain containing 2
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000202116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034867.1-1039s1c1
Sequence:CCGGCTTGCCTATACCAACCTCTCTCTCGAGAGAGAGGTTGGTATAGGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034867.1-1186s1c1
Sequence:CCGGGAGCTTCAAGTTCTGACCAAACTCGAGTTTGGTCAGAACTTGAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034867
PM20D2 MISSION shRNA Lentiviral Transduction Particles
peptidase M20 domain containing 2
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000202116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034867.1-1039s1c1
Sequence:CCGGCTTGCCTATACCAACCTCTCTCTCGAGAGAGAGGTTGGTATAGGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034867.1-1186s1c1
Sequence:CCGGGAGCTTCAAGTTCTGACCAAACTCGAGTTTGGTCAGAACTTGAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)