EMAIL THIS PAGE TO A FRIEND

PMAIP1

phorbol-12-myristate-13-acetate-induced protein 1

83 Gene Product Result for
Synonyms: APR NOXA
UniProtKB ID: Q13794, B2R4T7
Gene ID:
Mouse(58801) phorbol-12-myristate-13-acetate-induced protein 1
Rat(492821) phorbol-12-myristate-13-acetate-induced protein 1
cow(100296226) phorbol-12-myristate-13-acetate-induced protein 1
sheep(101102359) phorbol-12-myristate-13-acetate-induced protein 1
Zebrafish(751765) phorbol-12-myristate-13-acetate-induced protein 1
dog(100502558) phorbol-12-myristate-13-acetate-induced protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021127 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021127 Rosetta Predictions human pricing
NM_001008385 Rosetta Predictions rat pricing
NM_021451 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136187 predicted 435
2 SASI_Hs01_00136188 predicted 434
3 SASI_Hs01_00136189 predicted 768
4 SASI_Hs01_00136192 predicted 562
5 SASI_Hs01_00136193 predicted 504
6 SASI_Hs01_00136195 predicted 676
7 SASI_Hs01_00136194 predicted 702
8 SASI_Hs02_00354641 predicted 457
9 SASI_Hs02_00354642 predicted 845
10 SASI_Hs02_00354643 predicted 844
11 SASI_Hs01_00136190 predicted 679
12 SASI_Hs01_00136191 predicted 634
13 SASI_Hs01_00136196 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044978 predicted 238
2 SASI_Rn01_00044980 predicted 13
3 SASI_Rn01_00044982 predicted 49
4 SASI_Rn01_00044983 predicted 152
5 SASI_Rn02_00199162 predicted 237
6 SASI_Rn01_00044985 predicted 222
7 SASI_Rn01_00044986 predicted 78
8 SASI_Rn02_00199163 predicted 83
9 SASI_Rn02_00199164 predicted 147
10 SASI_Rn02_00199165 predicted 227
11 SASI_Rn01_00044979 predicted 239
12 SASI_Rn01_00044981 predicted 148
13 SASI_Rn01_00044984 predicted 232
14 SASI_Rn01_00044987 predicted 68
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077285 predicted 903
2 SASI_Mm01_00077286 predicted 958
3 SASI_Mm01_00077288 predicted 956
4 SASI_Mm01_00077289 predicted 968
5 SASI_Mm01_00077290 predicted 421
6 SASI_Mm01_00077291 predicted 960
7 SASI_Mm01_00077292 predicted 250
8 SASI_Mm01_00077293 predicted 268
9 SASI_Mm01_00077294 predicted 958
10 SASI_Mm02_00326103 predicted 937
11 SASI_Mm01_00077287 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021127
VALIDATED
PMAIP1 MISSION shRNA Bacterial Glycerol Stock
phorbol-12-myristate-13-acetate-induced protein 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-303s21c1
Sequence:CCGGCTCAGGAGATTTGGAGACAAACTCGAGTTTGTCTCCAAATCTCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-258s1c1
Sequence:CCGGCTCAGGAGATTTGGAGACAAACTCGAGTTTGTCTCCAAATCTCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-247s1c1
Sequence:CCGGGTGCTACTCAACTCAGGAGATCTCGAGATCTCCTGAGTTGAGTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-284s1c1
Sequence:CCGGCTTCCGGCAGAAACTTCTGAACTCGAGTTCAGAAGTTTCTGCCGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021127.1-275s1c1
Sequence:CCGGCAAACTGAACTTCCGGCAGAACTCGAGTTCTGCCGGAAGTTCAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-280s21c1
Sequence:CCGGTGGAAGTCGAGTGTGCTACTCCTCGAGGAGTAGCACACTCGACTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-290s1c1
Sequence:CCGGGCAGAAACTTCTGAATCTGATCTCGAGATCAGATTCAGAAGTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021127.1-300s1c1
Sequence:CCGGCTGAATCTGATATCCAAACTCCTCGAGGAGTTTGGATATCAGATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-373s21c1
Sequence:CCGGCAGGAACCTGACTGCATCAAACTCGAGTTTGATGCAGTCAGGTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-335s21c1
Sequence:CCGGGCAGAAACTTCTGAATCTGATCTCGAGATCAGATTCAGAAGTTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-265s1c1
Sequence:CCGGGATTTGGAGACAAACTGAACTCTCGAGAGTTCAGTTTGTCTCCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-778s21c1
Sequence:CCGGGCATTGTTGTTGTTGCTGTTTCTCGAGAAACAGCAACAACAACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151311    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021127.1-931s1c1
Sequence:CCGGGCTTCTGTTCAGATGATCTTTCTCGAGAAAGATCATCTGAACAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-733s1c1
Sequence:CCGGGCATTGTTGTTGTTGCTGTTTCTCGAGAAACAGCAACAACAACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021127
VALIDATED
PMAIP1 MISSION shRNA shRNA Plasmid DNA
phorbol-12-myristate-13-acetate-induced protein 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-303s21c1
Sequence:CCGGCTCAGGAGATTTGGAGACAAACTCGAGTTTGTCTCCAAATCTCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-258s1c1
Sequence:CCGGCTCAGGAGATTTGGAGACAAACTCGAGTTTGTCTCCAAATCTCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-247s1c1
Sequence:CCGGGTGCTACTCAACTCAGGAGATCTCGAGATCTCCTGAGTTGAGTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-284s1c1
Sequence:CCGGCTTCCGGCAGAAACTTCTGAACTCGAGTTCAGAAGTTTCTGCCGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021127.1-275s1c1
Sequence:CCGGCAAACTGAACTTCCGGCAGAACTCGAGTTCTGCCGGAAGTTCAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-280s21c1
Sequence:CCGGTGGAAGTCGAGTGTGCTACTCCTCGAGGAGTAGCACACTCGACTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-290s1c1
Sequence:CCGGGCAGAAACTTCTGAATCTGATCTCGAGATCAGATTCAGAAGTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021127.1-300s1c1
Sequence:CCGGCTGAATCTGATATCCAAACTCCTCGAGGAGTTTGGATATCAGATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-373s21c1
Sequence:CCGGCAGGAACCTGACTGCATCAAACTCGAGTTTGATGCAGTCAGGTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-335s21c1
Sequence:CCGGGCAGAAACTTCTGAATCTGATCTCGAGATCAGATTCAGAAGTTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-265s1c1
Sequence:CCGGGATTTGGAGACAAACTGAACTCTCGAGAGTTCAGTTTGTCTCCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-778s21c1
Sequence:CCGGGCATTGTTGTTGTTGCTGTTTCTCGAGAAACAGCAACAACAACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151311    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021127.1-931s1c1
Sequence:CCGGGCTTCTGTTCAGATGATCTTTCTCGAGAAAGATCATCTGAACAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-733s1c1
Sequence:CCGGGCATTGTTGTTGTTGCTGTTTCTCGAGAAACAGCAACAACAACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021127
VALIDATED
PMAIP1 MISSION shRNA Lentiviral Transduction Particles
phorbol-12-myristate-13-acetate-induced protein 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-303s21c1
Sequence:CCGGCTCAGGAGATTTGGAGACAAACTCGAGTTTGTCTCCAAATCTCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-258s1c1
Sequence:CCGGCTCAGGAGATTTGGAGACAAACTCGAGTTTGTCTCCAAATCTCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-247s1c1
Sequence:CCGGGTGCTACTCAACTCAGGAGATCTCGAGATCTCCTGAGTTGAGTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-284s1c1
Sequence:CCGGCTTCCGGCAGAAACTTCTGAACTCGAGTTCAGAAGTTTCTGCCGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021127.1-275s1c1
Sequence:CCGGCAAACTGAACTTCCGGCAGAACTCGAGTTCTGCCGGAAGTTCAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-280s21c1
Sequence:CCGGTGGAAGTCGAGTGTGCTACTCCTCGAGGAGTAGCACACTCGACTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-290s1c1
Sequence:CCGGGCAGAAACTTCTGAATCTGATCTCGAGATCAGATTCAGAAGTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021127.1-300s1c1
Sequence:CCGGCTGAATCTGATATCCAAACTCCTCGAGGAGTTTGGATATCAGATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-373s21c1
Sequence:CCGGCAGGAACCTGACTGCATCAAACTCGAGTTTGATGCAGTCAGGTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-335s21c1
Sequence:CCGGGCAGAAACTTCTGAATCTGATCTCGAGATCAGATTCAGAAGTTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-265s1c1
Sequence:CCGGGATTTGGAGACAAACTGAACTCTCGAGAGTTCAGTTTGTCTCCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021127.2-778s21c1
Sequence:CCGGGCATTGTTGTTGTTGCTGTTTCTCGAGAAACAGCAACAACAACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151311    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021127.1-931s1c1
Sequence:CCGGGCTTCTGTTCAGATGATCTTTCTCGAGAAAGATCATCTGAACAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021127.1-733s1c1
Sequence:CCGGGCATTGTTGTTGTTGCTGTTTCTCGAGAAACAGCAACAACAACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021451
VALIDATED
PMAIP1 MISSION shRNA Bacterial Glycerol Stock
phorbol-12-myristate-13-acetate-induced protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021451.2-438s21c1
Sequence:CCGGTGATTTCCAAGCTCTTCAATTCTCGAGAATTGAAGAGCTTGGAAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021451.2-968s21c1
Sequence:CCGGCGTGTGTTATTGTAAGCATTACTCGAGTAATGCTTACAATAACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021451.2-397s21c1
Sequence:CCGGGATTGGAGACAAAGTGAATTTCTCGAGAAATTCACTTTGTCTCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021451.2-243s21c1
Sequence:CCGGAGATCGGAGACAAAGTGTATTCTCGAGAATACACTTTGTCTCCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021451.2-363s21c1
Sequence:CCGGCAGACTTGAAGGACGAGTGTGCTCGAGCACACTCGTCCTTCAAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021451.1-968s1c1
Sequence:CCGGCGTGTGTTATTGTAAGCATTACTCGAGTAATGCTTACAATAACACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021451.1-444s1c1
Sequence:CCGGCCAAGCTCTTCAATTTAGTAACTCGAGTTACTAAATTGAAGAGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021451.1-275s1c1
Sequence:CCGGGCACCGGACATAACTGTGGTTCTCGAGAACCACAGTTATGTCCGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021451.1-215s1c1
Sequence:CCGGCCACCTGAGTTCGCAGCTCAACTCGAGTTGAGCTGCGAACTCAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021451.1-397s1c1
Sequence:CCGGGATTGGAGACAAAGTGAATTTCTCGAGAAATTCACTTTGTCTCCAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021451
VALIDATED
PMAIP1 MISSION shRNA shRNA Plasmid DNA
phorbol-12-myristate-13-acetate-induced protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021451.2-438s21c1
Sequence:CCGGTGATTTCCAAGCTCTTCAATTCTCGAGAATTGAAGAGCTTGGAAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021451.2-968s21c1
Sequence:CCGGCGTGTGTTATTGTAAGCATTACTCGAGTAATGCTTACAATAACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021451.2-397s21c1
Sequence:CCGGGATTGGAGACAAAGTGAATTTCTCGAGAAATTCACTTTGTCTCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021451.2-243s21c1
Sequence:CCGGAGATCGGAGACAAAGTGTATTCTCGAGAATACACTTTGTCTCCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021451.2-363s21c1
Sequence:CCGGCAGACTTGAAGGACGAGTGTGCTCGAGCACACTCGTCCTTCAAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021451.1-968s1c1
Sequence:CCGGCGTGTGTTATTGTAAGCATTACTCGAGTAATGCTTACAATAACACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021451.1-444s1c1
Sequence:CCGGCCAAGCTCTTCAATTTAGTAACTCGAGTTACTAAATTGAAGAGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021451.1-275s1c1
Sequence:CCGGGCACCGGACATAACTGTGGTTCTCGAGAACCACAGTTATGTCCGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021451.1-215s1c1
Sequence:CCGGCCACCTGAGTTCGCAGCTCAACTCGAGTTGAGCTGCGAACTCAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021451.1-397s1c1
Sequence:CCGGGATTGGAGACAAAGTGAATTTCTCGAGAAATTCACTTTGTCTCCAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021451
VALIDATED
PMAIP1 MISSION shRNA Lentiviral Transduction Particles
phorbol-12-myristate-13-acetate-induced protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021451.2-438s21c1
Sequence:CCGGTGATTTCCAAGCTCTTCAATTCTCGAGAATTGAAGAGCTTGGAAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021451.2-968s21c1
Sequence:CCGGCGTGTGTTATTGTAAGCATTACTCGAGTAATGCTTACAATAACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021451.2-397s21c1
Sequence:CCGGGATTGGAGACAAAGTGAATTTCTCGAGAAATTCACTTTGTCTCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021451.2-243s21c1
Sequence:CCGGAGATCGGAGACAAAGTGTATTCTCGAGAATACACTTTGTCTCCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021451.2-363s21c1
Sequence:CCGGCAGACTTGAAGGACGAGTGTGCTCGAGCACACTCGTCCTTCAAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021451.1-968s1c1
Sequence:CCGGCGTGTGTTATTGTAAGCATTACTCGAGTAATGCTTACAATAACACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021451.1-444s1c1
Sequence:CCGGCCAAGCTCTTCAATTTAGTAACTCGAGTTACTAAATTGAAGAGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021451.1-275s1c1
Sequence:CCGGGCACCGGACATAACTGTGGTTCTCGAGAACCACAGTTATGTCCGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021451.1-215s1c1
Sequence:CCGGCCACCTGAGTTCGCAGCTCAACTCGAGTTGAGCTGCGAACTCAGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021451.1-397s1c1
Sequence:CCGGGATTGGAGACAAAGTGAATTTCTCGAGAAATTCACTTTGTCTCCAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)