EMAIL THIS PAGE TO A FRIEND

PMCHL1

pro-melanin-concentrating hormone-like 1, pseudogene

71 Gene Product Result for
Species: Human PMCHL1(5369)
UniProtKB ID: Q16048, Q9BQ10
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031887 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031887 Rosetta Predictions human pricing
NR_003921 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079210 predicted 420
2 SASI_Hs01_00079211 predicted 421
3 SASI_Hs01_00079212 predicted 357
4 SASI_Hs01_00079213 predicted 252
5 SASI_Hs01_00079214 predicted 306
6 SASI_Hs01_00079215 predicted 364
7 SASI_Hs01_00079216 predicted 274
8 SASI_Hs01_00079217 predicted 372
9 SASI_Hs01_00079218 predicted 418
10 SASI_Hs01_00079219 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380501 predicted 311
2 SASI_Hs02_00380502 predicted 308
3 SASI_Hs02_00380503 predicted 258
4 SASI_Hs02_00380504 predicted 261
5 SASI_Hs02_00380505 predicted 235
6 SASI_Hs02_00380506 predicted 304
7 SASI_Hs02_00380507 predicted 308
8 SASI_Hs02_00380508 predicted 306
9 SASI_Hs02_00380509 predicted 229
10 SASI_Hs02_00380510 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031887
PMCHL1 MISSION shRNA Bacterial Glycerol Stock
pro-melanin-concentrating hormone-like 1, pseudogene
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031887.2-664s1c1
Sequence:CCGGGCCTGTGTTCTGTAAAGAGAACTCGAGTTCTCTTTACAGAACACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-142s1c1
Sequence:CCGGGTTCAGGATACCGAATCAACACTCGAGTGTTGATTCGGTATCCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-104s1c1
Sequence:CCGGCACTAGAAGGATCTGTAGCTTCTCGAGAAGCTACAGATCCTTCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-70s1c1
Sequence:CCGGCTGTCACTGAATCTGGTTATACTCGAGTATAACCAGATTCAGTGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-57s1c1
Sequence:CCGGCTTAAATCATGGTCTGTCACTCTCGAGAGTGACAGACCATGATTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-148s1c1
Sequence:CCGGGATACCGAATCAACACAAGAACTCGAGTTCTTGTGTTGATTCGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031887
PMCHL1 MISSION shRNA shRNA Plasmid DNA
pro-melanin-concentrating hormone-like 1, pseudogene
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031887.2-664s1c1
Sequence:CCGGGCCTGTGTTCTGTAAAGAGAACTCGAGTTCTCTTTACAGAACACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-142s1c1
Sequence:CCGGGTTCAGGATACCGAATCAACACTCGAGTGTTGATTCGGTATCCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-104s1c1
Sequence:CCGGCACTAGAAGGATCTGTAGCTTCTCGAGAAGCTACAGATCCTTCTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-70s1c1
Sequence:CCGGCTGTCACTGAATCTGGTTATACTCGAGTATAACCAGATTCAGTGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-57s1c1
Sequence:CCGGCTTAAATCATGGTCTGTCACTCTCGAGAGTGACAGACCATGATTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-148s1c1
Sequence:CCGGGATACCGAATCAACACAAGAACTCGAGTTCTTGTGTTGATTCGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031887
PMCHL1 MISSION shRNA Lentiviral Transduction Particles
pro-melanin-concentrating hormone-like 1, pseudogene
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031887.2-664s1c1
Sequence:CCGGGCCTGTGTTCTGTAAAGAGAACTCGAGTTCTCTTTACAGAACACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-142s1c1
Sequence:CCGGGTTCAGGATACCGAATCAACACTCGAGTGTTGATTCGGTATCCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-104s1c1
Sequence:CCGGCACTAGAAGGATCTGTAGCTTCTCGAGAAGCTACAGATCCTTCTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-70s1c1
Sequence:CCGGCTGTCACTGAATCTGGTTATACTCGAGTATAACCAGATTCAGTGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-57s1c1
Sequence:CCGGCTTAAATCATGGTCTGTCACTCTCGAGAGTGACAGACCATGATTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031887.2-148s1c1
Sequence:CCGGGATACCGAATCAACACAAGAACTCGAGTTCTTGTGTTGATTCGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)