EMAIL THIS PAGE TO A FRIEND

PMEL

premelanosome protein

95 Gene Product Result for
Synonyms: D12S53E ME20 ME20-M ME20M P1 P100 PMEL17 SI SIL SILV gp100
Gene ID:
Human(6490) Summary: This gene encodes a melanocyte-specific type I transmembrane glycoprotein. The encoded protein is enriched in melanosomes, which are the melanin-producing organelles in melanocytes, and plays an essential role in the structural organization of premelanosomes. This protein is involved in generating internal matrix fibers that define the transition from Stage I to Stage II melanosomes. This protein undergoes a complex pattern of prosttranslational processing and modification that is essential to the proper functioning of the protein. A secreted form of this protein that is released by proteolytic ectodomain shedding may be used as a melanoma-specific serum marker. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
Mouse(20431) premelanosome protein
Rat(362818) premelanosome protein
chicken(396007) premelanosome protein
domestic cat(101092774) premelanosome protein
dog(481102) premelanosome protein
cow(281487) premelanosome protein
sheep(101112637) premelanosome protein
naked mole-rat(101724736) premelanosome protein
Domestic Rabbit(100347477) premelanosome protein
domestic guinea pig(100714975) premelanosome protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006928 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006928 Rosetta Predictions human pricing
NM_001108729 Rosetta Predictions rat pricing
NM_021882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342625 predicted 1454
2 SASI_Hs01_00134331 predicted 266
3 SASI_Hs01_00134332 predicted 613
4 SASI_Hs02_00342626 predicted 1448
5 SASI_Hs02_00342627 predicted 1445
6 SASI_Hs02_00342628 predicted 1347
7 SASI_Hs02_00342629 predicted 1349
8 SASI_Hs02_00342630 predicted 949
9 SASI_Hs01_00134334 predicted 608
10 SASI_Hs02_00342631 predicted 1236
11 SASI_Hs01_00134330 predicted 497
12 SASI_Hs01_00134333 predicted 1783
13 SASI_Hs01_00134335 predicted 1872
14 SASI_Hs01_00134336 predicted 1736
15 SASI_Hs01_00134337 predicted 624
16 SASI_Hs01_00134338 predicted 240
17 SASI_Hs01_00134339 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108729 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241505 predicted 853
2 SASI_Rn02_00241506 predicted 1296
3 SASI_Rn02_00241507 predicted 882
4 SASI_Rn02_00241508 predicted 1263
5 SASI_Rn02_00241509 predicted 985
6 SASI_Rn02_00241510 predicted 845
7 SASI_Rn02_00241511 predicted 444
8 SASI_Rn02_00241512 predicted 660
9 SASI_Rn02_00241513 predicted 258
10 SASI_Rn02_00241514 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200027 predicted 1096
2 SASI_Mm01_00200028 predicted 572
3 SASI_Mm01_00200029 predicted 1610
4 SASI_Mm01_00200030 predicted 217
5 SASI_Mm02_00326442 predicted 320
6 SASI_Mm02_00326443 predicted 1588
7 SASI_Mm01_00200031 predicted 1155
8 SASI_Mm01_00200032 predicted 1441
9 SASI_Mm01_00200033 predicted 231
10 SASI_Mm01_00200034 predicted 717
11 SASI_Mm01_00200025 predicted 1766
12 SASI_Mm01_00200026 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021882
VALIDATED
PMEL MISSION shRNA Bacterial Glycerol Stock
premelanosome protein
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-457s21c1
Sequence:CCGGTCCGAAGAGAAGCTTTGTTTACTCGAGTAAACAAAGCTTCTCTTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-248s21c1
Sequence:CCGGCCTACACTGGTTGGTGCAAATCTCGAGATTTGCACCAACCAGTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-1126s21c1
Sequence:CCGGGACCTCAGCGGTCATAGATACCTCGAGGTATCTATGACCGCTGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-1756s21c1
Sequence:CCGGCCTTGCATCTCTGATACATAGCTCGAGCTATGTATCAGAGATGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021882.2-132s1c1
Sequence:CCGGCCAAGACAACTTGTAACTAAACTCGAGTTTAGTTACAAGTTGTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021882.2-1611s1c1
Sequence:CCGGTCAGGGACATATTGCCTCAATCTCGAGATTGAGGCAATATGTCCCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021882.2-1386s1c1
Sequence:CCGGCTGGACATTGTCCAGGGTATTCTCGAGAATACCCTGGACAATGTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-339s21c1
Sequence:CCGGCCAACAACACCATCATCAATGCTCGAGCATTGATGATGGTGTTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021882.2-1310s1c1
Sequence:CCGGCGACACCATAATGCTTGTGAACTCGAGTTCACAAGCATTATGGTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021882.2-1069s1c1
Sequence:CCGGCCACAGTTGTACAAATGCCAACTCGAGTTGGCATTTGTACAACTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-1346s21c1
Sequence:CCGGGACTGTGTTCTATATCGATATCTCGAGATATCGATATAGAACACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021882
VALIDATED
PMEL MISSION shRNA shRNA Plasmid DNA
premelanosome protein
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-457s21c1
Sequence:CCGGTCCGAAGAGAAGCTTTGTTTACTCGAGTAAACAAAGCTTCTCTTCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-248s21c1
Sequence:CCGGCCTACACTGGTTGGTGCAAATCTCGAGATTTGCACCAACCAGTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-1126s21c1
Sequence:CCGGGACCTCAGCGGTCATAGATACCTCGAGGTATCTATGACCGCTGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-1756s21c1
Sequence:CCGGCCTTGCATCTCTGATACATAGCTCGAGCTATGTATCAGAGATGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021882.2-132s1c1
Sequence:CCGGCCAAGACAACTTGTAACTAAACTCGAGTTTAGTTACAAGTTGTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021882.2-1611s1c1
Sequence:CCGGTCAGGGACATATTGCCTCAATCTCGAGATTGAGGCAATATGTCCCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021882.2-1386s1c1
Sequence:CCGGCTGGACATTGTCCAGGGTATTCTCGAGAATACCCTGGACAATGTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-339s21c1
Sequence:CCGGCCAACAACACCATCATCAATGCTCGAGCATTGATGATGGTGTTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021882.2-1310s1c1
Sequence:CCGGCGACACCATAATGCTTGTGAACTCGAGTTCACAAGCATTATGGTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021882.2-1069s1c1
Sequence:CCGGCCACAGTTGTACAAATGCCAACTCGAGTTGGCATTTGTACAACTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-1346s21c1
Sequence:CCGGGACTGTGTTCTATATCGATATCTCGAGATATCGATATAGAACACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021882
VALIDATED
PMEL MISSION shRNA Lentiviral Transduction Particles
premelanosome protein
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-457s21c1
Sequence:CCGGTCCGAAGAGAAGCTTTGTTTACTCGAGTAAACAAAGCTTCTCTTCGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-248s21c1
Sequence:CCGGCCTACACTGGTTGGTGCAAATCTCGAGATTTGCACCAACCAGTGTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-1126s21c1
Sequence:CCGGGACCTCAGCGGTCATAGATACCTCGAGGTATCTATGACCGCTGAGGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-1756s21c1
Sequence:CCGGCCTTGCATCTCTGATACATAGCTCGAGCTATGTATCAGAGATGCAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021882.2-132s1c1
Sequence:CCGGCCAAGACAACTTGTAACTAAACTCGAGTTTAGTTACAAGTTGTCTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021882.2-1611s1c1
Sequence:CCGGTCAGGGACATATTGCCTCAATCTCGAGATTGAGGCAATATGTCCCTGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021882.2-1386s1c1
Sequence:CCGGCTGGACATTGTCCAGGGTATTCTCGAGAATACCCTGGACAATGTCCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-339s21c1
Sequence:CCGGCCAACAACACCATCATCAATGCTCGAGCATTGATGATGGTGTTGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021882.2-1310s1c1
Sequence:CCGGCGACACCATAATGCTTGTGAACTCGAGTTCACAAGCATTATGGTGTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021882.2-1069s1c1
Sequence:CCGGCCACAGTTGTACAAATGCCAACTCGAGTTGGCATTTGTACAACTGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021882.4-1346s21c1
Sequence:CCGGGACTGTGTTCTATATCGATATCTCGAGATATCGATATAGAACACAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006928
PMEL MISSION shRNA Bacterial Glycerol Stock
premelanosome protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000160012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1885s1c1
Sequence:CCGGCAGACTTATGAAGCAAGACTTCTCGAGAAGTCTTGCTTCATAAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1359s1c1
Sequence:CCGGCAATCATGTCTACGGAAAGTACTCGAGTACTTTCCGTAGACATGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-280s1c1
Sequence:CCGGCTTCTCTATTGCCTTGAACTTCTCGAGAAGTTCAAGGCAATAGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1884s1c1
Sequence:CCGGGCAGACTTATGAAGCAAGACTCTCGAGAGTCTTGCTTCATAAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1017s1c1
Sequence:CCGGCTACAGAAGTTGTGGGTACTACTCGAGTAGTACCCACAACTTCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-253s1c1
Sequence:CCGGGCCTACACTGATTGGTGCAAACTCGAGTTTGCACCAATCAGTGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1356s1c1
Sequence:CCGGGCTCAATCATGTCTACGGAAACTCGAGTTTCCGTAGACATGATTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-331s1c1
Sequence:CCGGGCAGGTTATCTGGGTCAACAACTCGAGTTGTTGACCCAGATAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1144s1c1
Sequence:CCGGCACAGGTATGACACCTGAGAACTCGAGTTCTCAGGTGTCATACCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006928
PMEL MISSION shRNA shRNA Plasmid DNA
premelanosome protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000160012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1885s1c1
Sequence:CCGGCAGACTTATGAAGCAAGACTTCTCGAGAAGTCTTGCTTCATAAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1359s1c1
Sequence:CCGGCAATCATGTCTACGGAAAGTACTCGAGTACTTTCCGTAGACATGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-280s1c1
Sequence:CCGGCTTCTCTATTGCCTTGAACTTCTCGAGAAGTTCAAGGCAATAGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1884s1c1
Sequence:CCGGGCAGACTTATGAAGCAAGACTCTCGAGAGTCTTGCTTCATAAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1017s1c1
Sequence:CCGGCTACAGAAGTTGTGGGTACTACTCGAGTAGTACCCACAACTTCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-253s1c1
Sequence:CCGGGCCTACACTGATTGGTGCAAACTCGAGTTTGCACCAATCAGTGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1356s1c1
Sequence:CCGGGCTCAATCATGTCTACGGAAACTCGAGTTTCCGTAGACATGATTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-331s1c1
Sequence:CCGGGCAGGTTATCTGGGTCAACAACTCGAGTTGTTGACCCAGATAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1144s1c1
Sequence:CCGGCACAGGTATGACACCTGAGAACTCGAGTTCTCAGGTGTCATACCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006928
PMEL MISSION shRNA Lentiviral Transduction Particles
premelanosome protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000160012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1885s1c1
Sequence:CCGGCAGACTTATGAAGCAAGACTTCTCGAGAAGTCTTGCTTCATAAGTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1359s1c1
Sequence:CCGGCAATCATGTCTACGGAAAGTACTCGAGTACTTTCCGTAGACATGATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-280s1c1
Sequence:CCGGCTTCTCTATTGCCTTGAACTTCTCGAGAAGTTCAAGGCAATAGAGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1884s1c1
Sequence:CCGGGCAGACTTATGAAGCAAGACTCTCGAGAGTCTTGCTTCATAAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1017s1c1
Sequence:CCGGCTACAGAAGTTGTGGGTACTACTCGAGTAGTACCCACAACTTCTGTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-253s1c1
Sequence:CCGGGCCTACACTGATTGGTGCAAACTCGAGTTTGCACCAATCAGTGTAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1356s1c1
Sequence:CCGGGCTCAATCATGTCTACGGAAACTCGAGTTTCCGTAGACATGATTGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-331s1c1
Sequence:CCGGGCAGGTTATCTGGGTCAACAACTCGAGTTGTTGACCCAGATAACCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006928.3-1144s1c1
Sequence:CCGGCACAGGTATGACACCTGAGAACTCGAGTTCTCAGGTGTCATACCTGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)