EMAIL THIS PAGE TO A FRIEND

PMEPA1

prostate transmembrane protein, androgen induced 1

203 Gene Product Result for
Synonyms: STAG1 TMEPAI
UniProtKB ID: Q969W9, Q5TDR6, Q8NER4, Q96B72, Q9UJD3
Gene ID:
Human(56937) Summary: This gene encodes a transmembrane protein that contains a Smad interacting motif (SIM). Expression of this gene is induced by androgens and transforming growth factor beta, and the encoded protein suppresses the androgen receptor and transforming growth factor beta signaling pathways though interactions with Smad proteins. Overexpression of this gene may play a role in multiple types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(65112) prostate transmembrane protein, androgen induced 1
Rat(311676) prostate transmembrane protein, androgen induced 1
Zebrafish(436853) prostate transmembrane protein, androgen induced 1
chicken(428166) prostate transmembrane protein, androgen induced 1
domestic cat(101093173) prostate transmembrane protein, androgen induced 1
dog(485945) prostate transmembrane protein, androgen induced 1
domestic guinea pig(100734396) prostate transmembrane protein, androgen induced 1
naked mole-rat(101709095) prostate transmembrane protein, androgen induced 1
cow(617469) prostate transmembrane protein, androgen induced 1
sheep(101103913) prostate transmembrane protein, androgen induced 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020182 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022995 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022995 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022995 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158351 MISSION® esiRNA esiRNA human PMEPA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020182 Rosetta Predictions human pricing
NM_199169 Rosetta Predictions human pricing
NM_199170 Rosetta Predictions human pricing
NM_199171 Rosetta Predictions human pricing
NM_001107807 Rosetta Predictions rat pricing
NM_022995 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184017 predicted 1297
2 SASI_Hs01_00184018 predicted 1595
3 SASI_Hs01_00184020 predicted 1209
4 SASI_Hs01_00184021 predicted 473
5 SASI_Hs01_00184023 predicted 674
6 SASI_Hs01_00184024 predicted 1306
7 SASI_Hs01_00184025 predicted 467
8 SASI_Hs02_00353096 predicted 959
9 SASI_Hs02_00353097 predicted 1293
10 SASI_Hs02_00353098 predicted 1026
11 SASI_Hs01_00184016 predicted 1211
12 SASI_Hs01_00184019 predicted 597
13 SASI_Hs01_00184022 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173876 predicted 904
2 SASI_Hs01_00173877 predicted 1195
3 SASI_Hs01_00173879 predicted 818
4 SASI_Hs01_00173880 predicted 286
5 SASI_Hs01_00173881 predicted 913
6 SASI_Hs01_00173882 predicted 899
7 SASI_Hs01_00173883 predicted 629
8 SASI_Hs01_00173884 predicted 560
9 SASI_Hs01_00173885 predicted 631
10 SASI_Hs02_00372605 predicted 818
11 SASI_Hs01_00173878 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212181 predicted 902
2 SASI_Hs01_00212182 predicted 1189
3 SASI_Hs01_00212184 predicted 814
4 SASI_Hs01_00212185 predicted 284
5 SASI_Hs01_00212186 predicted 906
6 SASI_Hs01_00212187 predicted 890
7 SASI_Hs01_00212188 predicted 627
8 SASI_Hs01_00212189 predicted 546
9 SASI_Hs01_00212190 predicted 627
10 SASI_Hs02_00372606 predicted 820
11 SASI_Hs01_00212183 predicted 188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141111 predicted 958
2 SASI_Hs01_00141112 predicted 1254
3 SASI_Hs01_00141114 predicted 872
4 SASI_Hs01_00141115 predicted 341
5 SASI_Hs01_00141116 predicted 966
6 SASI_Hs01_00141117 predicted 948
7 SASI_Hs01_00141118 predicted 689
8 SASI_Hs01_00141119 predicted 610
9 SASI_Hs01_00141120 predicted 690
10 SASI_Hs02_00372607 predicted 879
11 SASI_Hs01_00141113 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232465 predicted 945
2 SASI_Rn02_00232466 predicted 180
3 SASI_Rn02_00232467 predicted 1206
4 SASI_Rn02_00232468 predicted 234
5 SASI_Rn02_00232469 predicted 189
6 SASI_Rn02_00232470 predicted 473
7 SASI_Rn02_00232471 predicted 918
8 SASI_Rn02_00232472 predicted 536
9 SASI_Rn02_00232473 predicted 542
10 SASI_Rn02_00232474 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022995 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031507 predicted 894
2 SASI_Mm02_00326719 predicted 1276
3 SASI_Mm01_00031509 predicted 892
4 SASI_Mm02_00326720 predicted 1427
5 SASI_Mm02_00326721 predicted 467
6 SASI_Mm02_00326722 predicted 538
7 SASI_Mm02_00326723 predicted 1444
8 SASI_Mm02_00326724 predicted 1596
9 SASI_Mm02_00326725 predicted 1008
10 SASI_Mm02_00326726 predicted 1473
11 SASI_Mm01_00031508 predicted 965
12 SASI_Mm01_00031510 predicted 893
13 SASI_Mm01_00031511 predicted 904
14 SASI_Mm01_00031512 predicted 595
15 SASI_Mm01_00031513 predicted 883
16 SASI_Mm01_00031514 predicted 627
17 SASI_Mm01_00031515 predicted 857
18 SASI_Mm01_00031516 predicted 590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020182
VALIDATED
PMEPA1 MISSION shRNA Bacterial Glycerol Stock
prostate transmembrane protein, androgen induced 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020182.x-4368s1c1
Sequence:CCGGGTCCCTATGAATTGTACGTTTCTCGAGAAACGTACAATTCATAGGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020182.x-426s1c1
Sequence:CCGGATCACGGAGCTGGAGTTTGTTCTCGAGAACAAACTCCAGCTCCGTGATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020182.x-438s1c1
Sequence:CCGGGAGTTTGTTCAGATCATCATCCTCGAGGATGATGATCTGAACAAACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020182.x-1145s1c1
Sequence:CCGGGAGCAAAGAGAAGGATAAACACTCGAGTGTTTATCCTTCTCTTTGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020182.x-1158s1c1
Sequence:CCGGGATAAACAGAAAGGACACCCTCTCGAGAGGGTGTCCTTTCTGTTTATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_020182.3-463s21c1
Sequence:CCGGTGCAACTGCAAACGCTCTTTGCTCGAGCAAAGAGCGTTTGCAGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020182.3-511s21c1
Sequence:CCGGGAGTTTGTTCAGATCATCATCCTCGAGGATGATGATCTGAACAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020182.3-4441s21c1
Sequence:CCGGGTCCCTATGAATTGTACGTTTCTCGAGAAACGTACAATTCATAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020182.3-1218s21c1
Sequence:CCGGGAGCAAAGAGAAGGATAAACACTCGAGTGTTTATCCTTCTCTTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_020182.3-685s21c1
Sequence:CCGGACAGTGTCAGGCAACGGAATCCTCGAGGATTCCGTTGCCTGACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020182
VALIDATED
PMEPA1 MISSION shRNA shRNA Plasmid DNA
prostate transmembrane protein, androgen induced 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020182.x-4368s1c1
Sequence:CCGGGTCCCTATGAATTGTACGTTTCTCGAGAAACGTACAATTCATAGGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020182.x-426s1c1
Sequence:CCGGATCACGGAGCTGGAGTTTGTTCTCGAGAACAAACTCCAGCTCCGTGATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020182.x-438s1c1
Sequence:CCGGGAGTTTGTTCAGATCATCATCCTCGAGGATGATGATCTGAACAAACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020182.x-1145s1c1
Sequence:CCGGGAGCAAAGAGAAGGATAAACACTCGAGTGTTTATCCTTCTCTTTGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020182.x-1158s1c1
Sequence:CCGGGATAAACAGAAAGGACACCCTCTCGAGAGGGTGTCCTTTCTGTTTATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_020182.3-463s21c1
Sequence:CCGGTGCAACTGCAAACGCTCTTTGCTCGAGCAAAGAGCGTTTGCAGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020182.3-511s21c1
Sequence:CCGGGAGTTTGTTCAGATCATCATCCTCGAGGATGATGATCTGAACAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020182.3-4441s21c1
Sequence:CCGGGTCCCTATGAATTGTACGTTTCTCGAGAAACGTACAATTCATAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020182.3-1218s21c1
Sequence:CCGGGAGCAAAGAGAAGGATAAACACTCGAGTGTTTATCCTTCTCTTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_020182.3-685s21c1
Sequence:CCGGACAGTGTCAGGCAACGGAATCCTCGAGGATTCCGTTGCCTGACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020182
VALIDATED
PMEPA1 MISSION shRNA Lentiviral Transduction Particles
prostate transmembrane protein, androgen induced 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020182.x-4368s1c1
Sequence:CCGGGTCCCTATGAATTGTACGTTTCTCGAGAAACGTACAATTCATAGGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020182.x-426s1c1
Sequence:CCGGATCACGGAGCTGGAGTTTGTTCTCGAGAACAAACTCCAGCTCCGTGATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020182.x-438s1c1
Sequence:CCGGGAGTTTGTTCAGATCATCATCCTCGAGGATGATGATCTGAACAAACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020182.x-1145s1c1
Sequence:CCGGGAGCAAAGAGAAGGATAAACACTCGAGTGTTTATCCTTCTCTTTGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020182.x-1158s1c1
Sequence:CCGGGATAAACAGAAAGGACACCCTCTCGAGAGGGTGTCCTTTCTGTTTATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_020182.3-463s21c1
Sequence:CCGGTGCAACTGCAAACGCTCTTTGCTCGAGCAAAGAGCGTTTGCAGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020182.3-511s21c1
Sequence:CCGGGAGTTTGTTCAGATCATCATCCTCGAGGATGATGATCTGAACAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020182.3-4441s21c1
Sequence:CCGGGTCCCTATGAATTGTACGTTTCTCGAGAAACGTACAATTCATAGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020182.3-1218s21c1
Sequence:CCGGGAGCAAAGAGAAGGATAAACACTCGAGTGTTTATCCTTCTCTTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_020182.3-685s21c1
Sequence:CCGGACAGTGTCAGGCAACGGAATCCTCGAGGATTCCGTTGCCTGACACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022995
VALIDATED
PMEPA1 MISSION shRNA Bacterial Glycerol Stock
prostate transmembrane protein, androgen induced 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022995.2-463s1c1
Sequence:CCGGCAAATCGTGGTCATCGTGGTACTCGAGTACCACGATGACCACGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022995.3-473s21c1
Sequence:CCGGGTCATCGTGGTAGTGATGATGCTCGAGCATCATCACTACCACGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022995.2-456s1c1
Sequence:CCGGGTTCGTGCAAATCGTGGTCATCTCGAGATGACCACGATTTGCACGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-626s21c1
Sequence:CCGGAGTACGGTGTCAGGTGGAATGCTCGAGCATTCCACCTGACACCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-737s21c1
Sequence:CCGGCCCTACCTGCAGCACGAAATTCTCGAGAATTTCGTGCTGCAGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-897s21c1
Sequence:CCGGTCTTCGACAGTGACCTTATAGCTCGAGCTATAAGGTCACTGTCGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022995.2-472s1c1
Sequence:CCGGGTCATCGTGGTAGTGATGATGCTCGAGCATCATCACTACCACGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022995.2-1053s1c1
Sequence:CCGGCTTCCAGCACCAGCAAAGTAACTCGAGTTACTTTGCTGGTGCTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-1462s21c1
Sequence:CCGGGTTGAGCTCTGTGCGTGAATGCTCGAGCATTCACGCACAGAGCTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-1626s21c1
Sequence:CCGGTGTATTAGAAGAGGCCTATTCCTCGAGGAATAGGCCTCTTCTAATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022995
VALIDATED
PMEPA1 MISSION shRNA shRNA Plasmid DNA
prostate transmembrane protein, androgen induced 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022995.2-463s1c1
Sequence:CCGGCAAATCGTGGTCATCGTGGTACTCGAGTACCACGATGACCACGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022995.3-473s21c1
Sequence:CCGGGTCATCGTGGTAGTGATGATGCTCGAGCATCATCACTACCACGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022995.2-456s1c1
Sequence:CCGGGTTCGTGCAAATCGTGGTCATCTCGAGATGACCACGATTTGCACGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-626s21c1
Sequence:CCGGAGTACGGTGTCAGGTGGAATGCTCGAGCATTCCACCTGACACCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-737s21c1
Sequence:CCGGCCCTACCTGCAGCACGAAATTCTCGAGAATTTCGTGCTGCAGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-897s21c1
Sequence:CCGGTCTTCGACAGTGACCTTATAGCTCGAGCTATAAGGTCACTGTCGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022995.2-472s1c1
Sequence:CCGGGTCATCGTGGTAGTGATGATGCTCGAGCATCATCACTACCACGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022995.2-1053s1c1
Sequence:CCGGCTTCCAGCACCAGCAAAGTAACTCGAGTTACTTTGCTGGTGCTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-1462s21c1
Sequence:CCGGGTTGAGCTCTGTGCGTGAATGCTCGAGCATTCACGCACAGAGCTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-1626s21c1
Sequence:CCGGTGTATTAGAAGAGGCCTATTCCTCGAGGAATAGGCCTCTTCTAATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022995
VALIDATED
PMEPA1 MISSION shRNA Lentiviral Transduction Particles
prostate transmembrane protein, androgen induced 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022995.2-463s1c1
Sequence:CCGGCAAATCGTGGTCATCGTGGTACTCGAGTACCACGATGACCACGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022995.3-473s21c1
Sequence:CCGGGTCATCGTGGTAGTGATGATGCTCGAGCATCATCACTACCACGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022995.2-456s1c1
Sequence:CCGGGTTCGTGCAAATCGTGGTCATCTCGAGATGACCACGATTTGCACGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-626s21c1
Sequence:CCGGAGTACGGTGTCAGGTGGAATGCTCGAGCATTCCACCTGACACCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-737s21c1
Sequence:CCGGCCCTACCTGCAGCACGAAATTCTCGAGAATTTCGTGCTGCAGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-897s21c1
Sequence:CCGGTCTTCGACAGTGACCTTATAGCTCGAGCTATAAGGTCACTGTCGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022995.2-472s1c1
Sequence:CCGGGTCATCGTGGTAGTGATGATGCTCGAGCATCATCACTACCACGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022995.2-1053s1c1
Sequence:CCGGCTTCCAGCACCAGCAAAGTAACTCGAGTTACTTTGCTGGTGCTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-1462s21c1
Sequence:CCGGGTTGAGCTCTGTGCGTGAATGCTCGAGCATTCACGCACAGAGCTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_022995.3-1626s21c1
Sequence:CCGGTGTATTAGAAGAGGCCTATTCCTCGAGGAATAGGCCTCTTCTAATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)