EMAIL THIS PAGE TO A FRIEND

PMF1

polyamine-modulated factor 1

62 Gene Product Result for
Gene ID:
Mouse(67037) polyamine-modulated factor 1
Rat(681050) polyamine-modulated factor 1
domestic cat(101083648) polyamine-modulated factor 1
dog(612152) polyamine-modulated factor 1
cow(616311) polyamine-modulated factor 1
Goat(100861218) polyamine-modulated factor 1
sheep(101102276) polyamine-modulated factor 1
domestic guinea pig(100721824) polyamine-modulated factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007221 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007221 Rosetta Predictions human pricing
XM_001060090 Rosetta Predictions rat pricing
NM_025928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153395 predicted 664
2 SASI_Hs01_00153396 predicted 202
3 SASI_Hs02_00343224 predicted 762
4 SASI_Hs01_00153397 predicted 231
5 SASI_Hs01_00153398 predicted 240
6 SASI_Hs01_00153399 predicted 221
7 SASI_Hs01_00153401 predicted 435
8 SASI_Hs01_00153402 predicted 220
9 SASI_Hs01_00153403 predicted 229
10 SASI_Hs01_00153404 predicted 320
11 SASI_Hs01_00153400 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295371 predicted 293
2 SASI_Rn02_00295372 predicted 358
3 SASI_Rn02_00295373 predicted 236
4 SASI_Rn02_00295374 predicted 301
5 SASI_Rn02_00295375 predicted 249
6 SASI_Rn02_00295376 predicted 356
7 SASI_Rn02_00295377 predicted 345
8 SASI_Rn02_00295378 predicted 212
9 SASI_Rn02_00295379 predicted 359
10 SASI_Rn02_00295380 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143415 predicted 436
2 SASI_Mm01_00143416 predicted 404
3 SASI_Mm01_00143417 predicted 428
4 SASI_Mm01_00143418 predicted 212
5 SASI_Mm02_00329305 predicted 213
6 SASI_Mm01_00143420 predicted 655
7 SASI_Mm01_00143422 predicted 251
8 SASI_Mm01_00143423 predicted 659
9 SASI_Mm02_00329306 predicted 560
10 SASI_Mm02_00329307 predicted 205
11 SASI_Mm01_00143414 predicted 317
12 SASI_Mm01_00143419 predicted 381
13 SASI_Mm01_00143421 predicted 202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007221
VALIDATED
PMF1 MISSION shRNA Bacterial Glycerol Stock
polyamine-modulated factor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007221.2-426s21c1
Sequence:CCGGAGTGTTATGGCACCCTACTTCCTCGAGGAAGTAGGGTGCCATAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007221.2-291s21c1
Sequence:CCGGGAGGAAATCTCTGACATCAAACTCGAGTTTGATGTCAGAGATTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007221.2-872s21c1
Sequence:CCGGTGGATAATTCTTGGCCATGTTCTCGAGAACATGGCCAAGAATTATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007221.1-156s1c1
Sequence:CCGGCCAGAGATTCACTGACTGCTACTCGAGTAGCAGTCAGTGAATCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007221.1-390s1c1
Sequence:CCGGGCACAGTGTTATAGCACCCTACTCGAGTAGGGTGCTATAACACTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007221.1-246s1c1
Sequence:CCGGGACATCTATCCGGGAGGAAATCTCGAGATTTCCTCCCGGATAGATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007221.2-664s21c1
Sequence:CCGGAGAGGGCAGTCAAGGTCAAGACTCGAGTCTTGACCTTGACTGCCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007221
VALIDATED
PMF1 MISSION shRNA shRNA Plasmid DNA
polyamine-modulated factor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007221.2-426s21c1
Sequence:CCGGAGTGTTATGGCACCCTACTTCCTCGAGGAAGTAGGGTGCCATAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007221.2-291s21c1
Sequence:CCGGGAGGAAATCTCTGACATCAAACTCGAGTTTGATGTCAGAGATTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007221.2-872s21c1
Sequence:CCGGTGGATAATTCTTGGCCATGTTCTCGAGAACATGGCCAAGAATTATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007221.1-156s1c1
Sequence:CCGGCCAGAGATTCACTGACTGCTACTCGAGTAGCAGTCAGTGAATCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007221.1-390s1c1
Sequence:CCGGGCACAGTGTTATAGCACCCTACTCGAGTAGGGTGCTATAACACTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007221.1-246s1c1
Sequence:CCGGGACATCTATCCGGGAGGAAATCTCGAGATTTCCTCCCGGATAGATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007221.2-664s21c1
Sequence:CCGGAGAGGGCAGTCAAGGTCAAGACTCGAGTCTTGACCTTGACTGCCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007221
VALIDATED
PMF1 MISSION shRNA Lentiviral Transduction Particles
polyamine-modulated factor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007221.2-426s21c1
Sequence:CCGGAGTGTTATGGCACCCTACTTCCTCGAGGAAGTAGGGTGCCATAACACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000418642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007221.2-291s21c1
Sequence:CCGGGAGGAAATCTCTGACATCAAACTCGAGTTTGATGTCAGAGATTTCCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000424926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007221.2-872s21c1
Sequence:CCGGTGGATAATTCTTGGCCATGTTCTCGAGAACATGGCCAAGAATTATCCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000022245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007221.1-156s1c1
Sequence:CCGGCCAGAGATTCACTGACTGCTACTCGAGTAGCAGTCAGTGAATCTCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000022246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007221.1-390s1c1
Sequence:CCGGGCACAGTGTTATAGCACCCTACTCGAGTAGGGTGCTATAACACTGTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000022248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007221.1-246s1c1
Sequence:CCGGGACATCTATCCGGGAGGAAATCTCGAGATTTCCTCCCGGATAGATGTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007221.2-664s21c1
Sequence:CCGGAGAGGGCAGTCAAGGTCAAGACTCGAGTCTTGACCTTGACTGCCCTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025928
VALIDATED
PMF1 MISSION shRNA Bacterial Glycerol Stock
polyamine-modulated factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-781s21c1
Sequence:CCGGCAGGCTTTGTCTTCTGGAGTTCTCGAGAACTCCAGAAGACAAAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-403s21c1
Sequence:CCGGAGTGTCATGGCACCCTACTTCCTCGAGGAAGTAGGGTGCCATGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-170s21c1
Sequence:CCGGGGTTCACCACCTGCTACAAACCTCGAGGTTTGTAGCAGGTGGTGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-115s21c1
Sequence:CCGGGACGCCATAGTAGACACTTTCCTCGAGGAAAGTGTCTACTATGGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-221s1c1
Sequence:CCGGGCAGAGGATCTATGACAAGTTCTCGAGAACTTGTCATAGATCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-317s21c1
Sequence:CCGGACTCCCTGGATAAGATCATAGCTCGAGCTATGATCTTATCCAGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-443s1c1
Sequence:CCGGCCTGTGTCATCAAGTACGGAACTCGAGTTCCGTACTTGATGACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-783s1c1
Sequence:CCGGCAGGCTTTGTCTTCTGGAGTTCTCGAGAACTCCAGAAGACAAAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-266s1c1
Sequence:CCGGCCGCGAGGAAATCTCAGAAATCTCGAGATTTCTGAGATTTCCTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-218s1c1
Sequence:CCGGGACGCAGAGGATCTATGACAACTCGAGTTGTCATAGATCCTCTGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025928
VALIDATED
PMF1 MISSION shRNA shRNA Plasmid DNA
polyamine-modulated factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-781s21c1
Sequence:CCGGCAGGCTTTGTCTTCTGGAGTTCTCGAGAACTCCAGAAGACAAAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-403s21c1
Sequence:CCGGAGTGTCATGGCACCCTACTTCCTCGAGGAAGTAGGGTGCCATGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-170s21c1
Sequence:CCGGGGTTCACCACCTGCTACAAACCTCGAGGTTTGTAGCAGGTGGTGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-115s21c1
Sequence:CCGGGACGCCATAGTAGACACTTTCCTCGAGGAAAGTGTCTACTATGGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-221s1c1
Sequence:CCGGGCAGAGGATCTATGACAAGTTCTCGAGAACTTGTCATAGATCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-317s21c1
Sequence:CCGGACTCCCTGGATAAGATCATAGCTCGAGCTATGATCTTATCCAGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-443s1c1
Sequence:CCGGCCTGTGTCATCAAGTACGGAACTCGAGTTCCGTACTTGATGACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-783s1c1
Sequence:CCGGCAGGCTTTGTCTTCTGGAGTTCTCGAGAACTCCAGAAGACAAAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-266s1c1
Sequence:CCGGCCGCGAGGAAATCTCAGAAATCTCGAGATTTCTGAGATTTCCTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-218s1c1
Sequence:CCGGGACGCAGAGGATCTATGACAACTCGAGTTGTCATAGATCCTCTGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025928
VALIDATED
PMF1 MISSION shRNA Lentiviral Transduction Particles
polyamine-modulated factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-781s21c1
Sequence:CCGGCAGGCTTTGTCTTCTGGAGTTCTCGAGAACTCCAGAAGACAAAGCCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000304388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-403s21c1
Sequence:CCGGAGTGTCATGGCACCCTACTTCCTCGAGGAAGTAGGGTGCCATGACACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000310926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-170s21c1
Sequence:CCGGGGTTCACCACCTGCTACAAACCTCGAGGTTTGTAGCAGGTGGTGAACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000310923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-115s21c1
Sequence:CCGGGACGCCATAGTAGACACTTTCCTCGAGGAAAGTGTCTACTATGGCGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000096615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-221s1c1
Sequence:CCGGGCAGAGGATCTATGACAAGTTCTCGAGAACTTGTCATAGATCCTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000304387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025928.3-317s21c1
Sequence:CCGGACTCCCTGGATAAGATCATAGCTCGAGCTATGATCTTATCCAGGGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000096618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-443s1c1
Sequence:CCGGCCTGTGTCATCAAGTACGGAACTCGAGTTCCGTACTTGATGACACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000096614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-783s1c1
Sequence:CCGGCAGGCTTTGTCTTCTGGAGTTCTCGAGAACTCCAGAAGACAAAGCCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000096616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-266s1c1
Sequence:CCGGCCGCGAGGAAATCTCAGAAATCTCGAGATTTCTGAGATTTCCTCGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000096617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025928.1-218s1c1
Sequence:CCGGGACGCAGAGGATCTATGACAACTCGAGTTGTCATAGATCCTCTGCGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???