EMAIL THIS PAGE TO A FRIEND

PMFBP1

polyamine modulated factor 1 binding protein 1

72 Gene Product Result for
UniProtKB ID: Q8TBY8, B3KVI9, H7BY07, Q8NA09, Q9BY16, Q9H0H4
Gene ID:
Mouse(56523) polyamine modulated factor 1 binding protein 1
Rat(171414) polyamine modulated factor 1 binding protein 1
domestic guinea pig(100721716) polyamine modulated factor 1 binding protein 1
naked mole-rat(101706707) polyamine modulated factor 1 binding protein 1
cow(523993) polyamine modulated factor 1 binding protein 1
sheep(101114461) polyamine modulated factor 1 binding protein 1
chicken(415871) polyamine modulated factor 1 binding protein 1
Horse(100067820) polyamine modulated factor 1 binding protein 1
dog(479670) polyamine modulated factor 1 binding protein 1
domestic cat(101099606) polyamine modulated factor 1 binding protein 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019938 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019938 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019938 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031293 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059181 MISSION® esiRNA esiRNA human PMFBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031293 Rosetta Predictions human pricing
NM_134393 Rosetta Predictions rat pricing
NM_019938 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128421 predicted 3094
2 SASI_Hs02_00358729 predicted 3155
3 SASI_Hs01_00128422 predicted 696
4 SASI_Hs01_00128423 predicted 928
5 SASI_Hs01_00128424 predicted 2787
6 SASI_Hs01_00128426 predicted 1325
7 SASI_Hs01_00128427 predicted 545
8 SASI_Hs01_00128428 predicted 775
9 SASI_Hs01_00128430 predicted 891
10 SASI_Hs02_00358730 predicted 655
11 SASI_Hs01_00128425 predicted 337
12 SASI_Hs01_00128429 predicted 1928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116959 predicted 1644
2 SASI_Rn01_00116960 predicted 1679
3 SASI_Rn01_00116961 predicted 2387
4 SASI_Rn01_00116962 predicted 2759
5 SASI_Rn01_00116964 predicted 1833
6 SASI_Rn01_00116965 predicted 2146
7 SASI_Rn01_00116966 predicted 1512
8 SASI_Rn01_00116967 predicted 651
9 SASI_Rn01_00116968 predicted 1859
10 SASI_Rn02_00267961 predicted 1499
11 SASI_Rn01_00116963 predicted 2176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193470 predicted 2478
2 SASI_Mm01_00193471 predicted 2626
3 SASI_Mm01_00193472 predicted 2265
4 SASI_Mm01_00193473 predicted 893
5 SASI_Mm01_00193474 predicted 2837
6 SASI_Mm01_00193475 predicted 1918
7 SASI_Mm01_00193476 predicted 593
8 SASI_Mm01_00193477 predicted 1886
9 SASI_Mm01_00193478 predicted 807
10 SASI_Mm01_00193479 predicted 2713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019938
PMFBP1 MISSION shRNA Bacterial Glycerol Stock
polyamine modulated factor 1 binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-2054s1c1
Sequence:CCGGGCTTTGCGACAAGAAGCGAAACTCGAGTTTCGCTTCTTGTCGCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-2827s1c1
Sequence:CCGGGCAGAAGATTGCCAATGAGAACTCGAGTTCTCATTGGCAATCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-2311s1c1
Sequence:CCGGCATGGTTAGTAAAGAAGCTTACTCGAGTAAGCTTCTTTACTAACCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-349s1c1
Sequence:CCGGCCGGGTCAATAAGCAATACCACTCGAGTGGTATTGCTTATTGACCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-1231s1c1
Sequence:CCGGCGTCATCGAGAAGAAGGACAACTCGAGTTGTCCTTCTTCTCGATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019938.1-3275s1c1
Sequence:CCGGGTTTGCAAGAAGTTATGCTTTCTCGAGAAAGCATAACTTCTTGCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019938.1-3267s1c1
Sequence:CCGGCCTGTTTAGTTTGCAAGAAGTCTCGAGACTTCTTGCAAACTAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-2468s1c1
Sequence:CCGGGAAGATGAAATCGCGGCTTATCTCGAGATAAGCCGCGATTTCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-203s1c1
Sequence:CCGGGACATCAAGAATCTCCACGATCTCGAGATCGTGGAGATTCTTGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-190s1c1
Sequence:CCGGGAGCCTACAACTGGACATCAACTCGAGTTGATGTCCAGTTGTAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019938
PMFBP1 MISSION shRNA shRNA Plasmid DNA
polyamine modulated factor 1 binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-2054s1c1
Sequence:CCGGGCTTTGCGACAAGAAGCGAAACTCGAGTTTCGCTTCTTGTCGCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-2827s1c1
Sequence:CCGGGCAGAAGATTGCCAATGAGAACTCGAGTTCTCATTGGCAATCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-2311s1c1
Sequence:CCGGCATGGTTAGTAAAGAAGCTTACTCGAGTAAGCTTCTTTACTAACCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-349s1c1
Sequence:CCGGCCGGGTCAATAAGCAATACCACTCGAGTGGTATTGCTTATTGACCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-1231s1c1
Sequence:CCGGCGTCATCGAGAAGAAGGACAACTCGAGTTGTCCTTCTTCTCGATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019938.1-3275s1c1
Sequence:CCGGGTTTGCAAGAAGTTATGCTTTCTCGAGAAAGCATAACTTCTTGCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019938.1-3267s1c1
Sequence:CCGGCCTGTTTAGTTTGCAAGAAGTCTCGAGACTTCTTGCAAACTAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-2468s1c1
Sequence:CCGGGAAGATGAAATCGCGGCTTATCTCGAGATAAGCCGCGATTTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-203s1c1
Sequence:CCGGGACATCAAGAATCTCCACGATCTCGAGATCGTGGAGATTCTTGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-190s1c1
Sequence:CCGGGAGCCTACAACTGGACATCAACTCGAGTTGATGTCCAGTTGTAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019938
PMFBP1 MISSION shRNA Lentiviral Transduction Particles
polyamine modulated factor 1 binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-2054s1c1
Sequence:CCGGGCTTTGCGACAAGAAGCGAAACTCGAGTTTCGCTTCTTGTCGCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-2827s1c1
Sequence:CCGGGCAGAAGATTGCCAATGAGAACTCGAGTTCTCATTGGCAATCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-2311s1c1
Sequence:CCGGCATGGTTAGTAAAGAAGCTTACTCGAGTAAGCTTCTTTACTAACCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-349s1c1
Sequence:CCGGCCGGGTCAATAAGCAATACCACTCGAGTGGTATTGCTTATTGACCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-1231s1c1
Sequence:CCGGCGTCATCGAGAAGAAGGACAACTCGAGTTGTCCTTCTTCTCGATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019938.1-3275s1c1
Sequence:CCGGGTTTGCAAGAAGTTATGCTTTCTCGAGAAAGCATAACTTCTTGCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019938.1-3267s1c1
Sequence:CCGGCCTGTTTAGTTTGCAAGAAGTCTCGAGACTTCTTGCAAACTAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-2468s1c1
Sequence:CCGGGAAGATGAAATCGCGGCTTATCTCGAGATAAGCCGCGATTTCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-203s1c1
Sequence:CCGGGACATCAAGAATCTCCACGATCTCGAGATCGTGGAGATTCTTGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019938.1-190s1c1
Sequence:CCGGGAGCCTACAACTGGACATCAACTCGAGTTGATGTCCAGTTGTAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031293
PMFBP1 MISSION shRNA Bacterial Glycerol Stock
polyamine modulated factor 1 binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-817s1c1
Sequence:CCGGCCTTGCATGATTCAAGAGCATCTCGAGATGCTCTTGAATCATGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-2737s21c1
Sequence:CCGGGAACCTCCTTGAGGACGATAACTCGAGTTATCGTCCTCAAGGAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-705s21c1
Sequence:CCGGTAAACCTCTACAGGGATAAATCTCGAGATTTATCCCTGTAGAGGTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-2811s21c1
Sequence:CCGGACCGAGGGAATGATCAGATTACTCGAGTAATCTGATCATTCCCTCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-937s21c1
Sequence:CCGGCATTCAAGAACTTCGAAATAACTCGAGTTATTTCGAAGTTCTTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-829s21c1
Sequence:CCGGTCATTCAAAGGTACGGATATACTCGAGTATATCCGTACCTTTGAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-2829s1c1
Sequence:CCGGCGCCAATGAGAAACTAGGAAACTCGAGTTTCCTAGTTTCTCATTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-1338s1c1
Sequence:CCGGCCTCCAAGAGAAAGATGAGATCTCGAGATCTCATCTTTCTCTTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-205s1c1
Sequence:CCGGGACATCAAGAATCTGCACGATCTCGAGATCGTGCAGATTCTTGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-2226s1c1
Sequence:CCGGCCTTCAGAAGGAGTCCTTAATCTCGAGATTAAGGACTCCTTCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031293
PMFBP1 MISSION shRNA shRNA Plasmid DNA
polyamine modulated factor 1 binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-817s1c1
Sequence:CCGGCCTTGCATGATTCAAGAGCATCTCGAGATGCTCTTGAATCATGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-2737s21c1
Sequence:CCGGGAACCTCCTTGAGGACGATAACTCGAGTTATCGTCCTCAAGGAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-705s21c1
Sequence:CCGGTAAACCTCTACAGGGATAAATCTCGAGATTTATCCCTGTAGAGGTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-2811s21c1
Sequence:CCGGACCGAGGGAATGATCAGATTACTCGAGTAATCTGATCATTCCCTCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-937s21c1
Sequence:CCGGCATTCAAGAACTTCGAAATAACTCGAGTTATTTCGAAGTTCTTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-829s21c1
Sequence:CCGGTCATTCAAAGGTACGGATATACTCGAGTATATCCGTACCTTTGAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-2829s1c1
Sequence:CCGGCGCCAATGAGAAACTAGGAAACTCGAGTTTCCTAGTTTCTCATTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-1338s1c1
Sequence:CCGGCCTCCAAGAGAAAGATGAGATCTCGAGATCTCATCTTTCTCTTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-205s1c1
Sequence:CCGGGACATCAAGAATCTGCACGATCTCGAGATCGTGCAGATTCTTGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-2226s1c1
Sequence:CCGGCCTTCAGAAGGAGTCCTTAATCTCGAGATTAAGGACTCCTTCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031293
PMFBP1 MISSION shRNA Lentiviral Transduction Particles
polyamine modulated factor 1 binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-817s1c1
Sequence:CCGGCCTTGCATGATTCAAGAGCATCTCGAGATGCTCTTGAATCATGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-2737s21c1
Sequence:CCGGGAACCTCCTTGAGGACGATAACTCGAGTTATCGTCCTCAAGGAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-705s21c1
Sequence:CCGGTAAACCTCTACAGGGATAAATCTCGAGATTTATCCCTGTAGAGGTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-2811s21c1
Sequence:CCGGACCGAGGGAATGATCAGATTACTCGAGTAATCTGATCATTCCCTCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-937s21c1
Sequence:CCGGCATTCAAGAACTTCGAAATAACTCGAGTTATTTCGAAGTTCTTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031293.2-829s21c1
Sequence:CCGGTCATTCAAAGGTACGGATATACTCGAGTATATCCGTACCTTTGAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-2829s1c1
Sequence:CCGGCGCCAATGAGAAACTAGGAAACTCGAGTTTCCTAGTTTCTCATTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-1338s1c1
Sequence:CCGGCCTCCAAGAGAAAGATGAGATCTCGAGATCTCATCTTTCTCTTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-205s1c1
Sequence:CCGGGACATCAAGAATCTGCACGATCTCGAGATCGTGCAGATTCTTGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031293.1-2226s1c1
Sequence:CCGGCCTTCAGAAGGAGTCCTTAATCTCGAGATTAAGGACTCCTTCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)