EMAIL THIS PAGE TO A FRIEND

PML

promyelocytic leukemia

394 Gene Product Result for
Synonyms: MYL PP8675 RNF71 TRIM19
Gene ID:
Human(5371) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(18854) promyelocytic leukemia
Rat(315713) promyelocytic leukemia
chicken(415302) promyelocytic leukemia
chicken(415304) promyelocytic leukemia
Horse(100062744) promyelocytic leukemia
domestic cat(101086975) promyelocytic leukemia
dog(487641) promyelocytic leukemia
cow(100138545) promyelocytic leukemia
sheep(101111580) promyelocytic leukemia
naked mole-rat(101707749) promyelocytic leukemia
domestic guinea pig(100720832) promyelocytic leukemia
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002675 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002675 Rosetta Predictions human pricing
NM_033238 Rosetta Predictions human pricing
NM_033239 Rosetta Predictions human pricing
NM_033240 Rosetta Predictions human pricing
NM_033242 Rosetta Predictions human pricing
NM_033244 Rosetta Predictions human pricing
NM_033245 Rosetta Predictions human pricing
NM_033246 Rosetta Predictions human pricing
NM_033247 Rosetta Predictions human pricing
NM_033249 Rosetta Predictions human pricing
NM_033250 Rosetta Predictions human pricing
XM_001074703 Rosetta Predictions rat pricing
XM_236296 Rosetta Predictions rat pricing
NM_008884 Rosetta Predictions mouse pricing
NM_178087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082728 predicted 642
2 SASI_Hs01_00082729 predicted 539
3 SASI_Hs01_00082730 predicted 498
4 SASI_Hs02_00334242 predicted 807
5 SASI_Hs01_00082731 predicted 681
6 SASI_Hs01_00082732 predicted 579
7 SASI_Hs01_00082733 predicted 739
8 SASI_Hs01_00082734 predicted 1041
9 SASI_Hs01_00082736 predicted 502
10 SASI_Hs01_00082737 predicted 739
11 SASI_Hs01_00082735 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182443 predicted 640
2 SASI_Hs01_00182444 predicted 539
3 SASI_Hs01_00182445 predicted 498
4 SASI_Hs02_00361038 predicted 806
5 SASI_Hs01_00182446 predicted 687
6 SASI_Hs01_00182447 predicted 583
7 SASI_Hs01_00182448 predicted 734
8 SASI_Hs01_00182449 predicted 1043
9 SASI_Hs01_00182451 predicted 496
10 SASI_Hs01_00182452 predicted 740
11 SASI_Hs01_00182450 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142105 predicted 648
2 SASI_Hs01_00142106 predicted 541
3 SASI_Hs01_00142107 predicted 494
4 SASI_Hs02_00361039 predicted 804
5 SASI_Hs01_00142108 predicted 688
6 SASI_Hs01_00142109 predicted 585
7 SASI_Hs01_00142110 predicted 740
8 SASI_Hs01_00142111 predicted 1044
9 SASI_Hs01_00142113 predicted 497
10 SASI_Hs01_00142114 predicted 734
11 SASI_Hs01_00142112 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185983 predicted 639
2 SASI_Hs01_00185984 predicted 539
3 SASI_Hs01_00185985 predicted 494
4 SASI_Hs02_00361040 predicted 804
5 SASI_Hs01_00185986 predicted 689
6 SASI_Hs01_00185987 predicted 582
7 SASI_Hs01_00185988 predicted 740
8 SASI_Hs01_00185989 predicted 1044
9 SASI_Hs01_00185991 predicted 500
10 SASI_Hs01_00185992 predicted 742
11 SASI_Hs01_00185990 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038613 predicted 652
2 SASI_Hs01_00038614 predicted 548
3 SASI_Hs01_00038615 predicted 500
4 SASI_Hs01_00038616 predicted 695
5 SASI_Hs01_00038617 predicted 588
6 SASI_Hs01_00038618 predicted 747
7 SASI_Hs01_00038619 predicted 1047
8 SASI_Hs01_00038620 predicted 517
9 SASI_Hs01_00038621 predicted 504
10 SASI_Hs01_00038622 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239572 predicted 642
2 SASI_Hs01_00239573 predicted 545
3 SASI_Hs01_00239574 predicted 489
4 SASI_Hs02_00361041 predicted 808
5 SASI_Hs01_00239575 predicted 687
6 SASI_Hs01_00239576 predicted 583
7 SASI_Hs01_00239577 predicted 739
8 SASI_Hs01_00239578 predicted 1042
9 SASI_Hs01_00239580 predicted 496
10 SASI_Hs01_00239581 predicted 734
11 SASI_Hs01_00239579 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182950 predicted 650
2 SASI_Hs01_00182951 predicted 545
3 SASI_Hs01_00182952 predicted 500
4 SASI_Hs01_00182953 predicted 686
5 SASI_Hs01_00182954 predicted 591
6 SASI_Hs01_00182955 predicted 737
7 SASI_Hs01_00182956 predicted 1047
8 SASI_Hs01_00182957 predicted 522
9 SASI_Hs01_00182958 predicted 505
10 SASI_Hs01_00182959 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036696 predicted 639
2 SASI_Hs01_00036697 predicted 540
3 SASI_Hs01_00036698 predicted 496
4 SASI_Hs02_00361042 predicted 803
5 SASI_Hs01_00036699 predicted 689
6 SASI_Hs01_00036700 predicted 585
7 SASI_Hs01_00036701 predicted 740
8 SASI_Hs01_00036702 predicted 1042
9 SASI_Hs01_00036704 predicted 502
10 SASI_Hs01_00036705 predicted 740
11 SASI_Hs01_00036703 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121567 predicted 644
2 SASI_Hs01_00121568 predicted 544
3 SASI_Hs01_00121569 predicted 494
4 SASI_Hs02_00361043 predicted 807
5 SASI_Hs01_00121570 predicted 685
6 SASI_Hs01_00121571 predicted 583
7 SASI_Hs01_00121572 predicted 741
8 SASI_Hs01_00121573 predicted 1044
9 SASI_Hs01_00121575 predicted 495
10 SASI_Hs01_00121576 predicted 737
11 SASI_Hs01_00121574 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163265 predicted 640
2 SASI_Hs01_00163266 predicted 542
3 SASI_Hs01_00163267 predicted 492
4 SASI_Hs02_00361044 predicted 808
5 SASI_Hs01_00163268 predicted 681
6 SASI_Hs01_00163269 predicted 583
7 SASI_Hs01_00163270 predicted 734
8 SASI_Hs01_00163271 predicted 1048
9 SASI_Hs01_00163273 predicted 501
10 SASI_Hs01_00163274 predicted 736
11 SASI_Hs01_00163272 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050324 predicted 646
2 SASI_Hs01_00050325 predicted 545
3 SASI_Hs01_00050326 predicted 489
4 SASI_Hs02_00361045 predicted 806
5 SASI_Hs01_00050327 predicted 687
6 SASI_Hs01_00050328 predicted 578
7 SASI_Hs01_00050329 predicted 736
8 SASI_Hs01_00050330 predicted 1048
9 SASI_Hs01_00050332 predicted 495
10 SASI_Hs01_00050333 predicted 734
11 SASI_Hs01_00050331 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347075 predicted 2587
2 SASI_Rn02_00347076 predicted 244
3 SASI_Rn02_00347077 predicted 2425
4 SASI_Rn02_00347078 predicted 1492
5 SASI_Rn02_00347079 predicted 508
6 SASI_Rn02_00347080 predicted 2533
7 SASI_Rn02_00347081 predicted 2653
8 SASI_Rn02_00347082 predicted 422
9 SASI_Rn02_00347083 predicted 1581
10 SASI_Rn02_00347084 predicted 2781
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389944 predicted 2428
2 SASI_Rn02_00389945 predicted 2005
3 SASI_Rn02_00389946 predicted 2530
4 SASI_Rn02_00389947 predicted 2526
5 SASI_Rn02_00389948 predicted 2627
6 SASI_Rn02_00389949 predicted 2415
7 SASI_Rn02_00389950 predicted 2382
8 SASI_Rn02_00389951 predicted 2075
9 SASI_Rn02_00389952 predicted 2466
10 SASI_Rn02_00389953 predicted 2021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314878 predicted 637
2 SASI_Mm02_00314879 predicted 247
3 SASI_Mm02_00314880 predicted 2512
4 SASI_Mm02_00314881 predicted 512
5 SASI_Mm02_00314882 predicted 1915
6 SASI_Mm02_00314883 predicted 2278
7 SASI_Mm02_00314884 predicted 661
8 SASI_Mm02_00314885 predicted 422
9 SASI_Mm02_00314886 predicted 780
10 SASI_Mm02_00314887 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348562 predicted 644
2 SASI_Mm02_00348563 predicted 245
3 SASI_Mm02_00348564 predicted 2650
4 SASI_Mm02_00348565 predicted 510
5 SASI_Mm02_00348566 predicted 2060
6 SASI_Mm02_00348567 predicted 2414
7 SASI_Mm02_00348568 predicted 661
8 SASI_Mm01_00120861 predicted 416
9 SASI_Mm02_00348569 predicted 779
10 SASI_Mm02_00348570 predicted 1034
11 SASI_Mm01_00120857 predicted 1790
12 SASI_Mm01_00120858 predicted 1832
13 SASI_Mm01_00120859 predicted 503
14 SASI_Mm01_00120860 predicted 1026
15 SASI_Mm01_00120862 predicted 465
16 SASI_Mm01_00120863 predicted 1785
17 SASI_Mm01_00120864 predicted 1812
18 SASI_Mm01_00120865 predicted 309
19 SASI_Mm01_00120866 predicted 1786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002675
VALIDATED
PML MISSION shRNA Bacterial Glycerol Stock
promyelocytic leukemia
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-1371s21c1
Sequence:CCGGAGGGACCCTATTGACGTTGACCTCGAGGTCAACGTCAATAGGGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-1500s21c1
Sequence:CCGGGTGTACGCCTTCTCCATCAAACTCGAGTTTGATGGAGAAGGCGTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-282s21c1
Sequence:CCGGTCGGAGGAGGAGTTCCAGTTTCTCGAGAAACTGGAACTCCTCCTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-1982s21c1
Sequence:CCGGCCTCAAGATTGACAATGAAAGCTCGAGCTTTCATTGTCAATCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-492s21c1
Sequence:CCGGGTGTACCGGCAGATTGTGGATCTCGAGATCCACAATCTGCCGGTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-680s21c1
Sequence:CCGGCACCCGCAAGACCAACAACATCTCGAGATGTTGTTGGTCTTGCGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-1322s21c1
Sequence:CCGGAGATGCAGCTGTATCCAAGAACTCGAGTTCTTGGATACAGCTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002675.x-681s1c1
Sequence:CCGGCACCCGCAAGACCAACAACATCTCGAGATGTTGTTGGTCTTGCGGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002675.x-1548s1c1
Sequence:CCGGCAATACAACGACAGCCCAGAACTCGAGTTCTGGGCTGTCGTTGTATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002675.x-1501s1c1
Sequence:CCGGGTGTACGCCTTCTCCATCAAACTCGAGTTTGATGGAGAAGGCGTACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002675.x-493s1c1
Sequence:CCGGGTGTACCGGCAGATTGTGGATCTCGAGATCCACAATCTGCCGGTACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002675.x-1497s1c1
Sequence:CCGGGCCAGTGTACGCCTTCTCCATCTCGAGATGGAGAAGGCGTACACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002675
VALIDATED
PML MISSION shRNA shRNA Plasmid DNA
promyelocytic leukemia
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-1371s21c1
Sequence:CCGGAGGGACCCTATTGACGTTGACCTCGAGGTCAACGTCAATAGGGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-1500s21c1
Sequence:CCGGGTGTACGCCTTCTCCATCAAACTCGAGTTTGATGGAGAAGGCGTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-282s21c1
Sequence:CCGGTCGGAGGAGGAGTTCCAGTTTCTCGAGAAACTGGAACTCCTCCTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-1982s21c1
Sequence:CCGGCCTCAAGATTGACAATGAAAGCTCGAGCTTTCATTGTCAATCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-492s21c1
Sequence:CCGGGTGTACCGGCAGATTGTGGATCTCGAGATCCACAATCTGCCGGTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-680s21c1
Sequence:CCGGCACCCGCAAGACCAACAACATCTCGAGATGTTGTTGGTCTTGCGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-1322s21c1
Sequence:CCGGAGATGCAGCTGTATCCAAGAACTCGAGTTCTTGGATACAGCTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002675.x-681s1c1
Sequence:CCGGCACCCGCAAGACCAACAACATCTCGAGATGTTGTTGGTCTTGCGGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002675.x-1548s1c1
Sequence:CCGGCAATACAACGACAGCCCAGAACTCGAGTTCTGGGCTGTCGTTGTATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002675.x-1501s1c1
Sequence:CCGGGTGTACGCCTTCTCCATCAAACTCGAGTTTGATGGAGAAGGCGTACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002675.x-493s1c1
Sequence:CCGGGTGTACCGGCAGATTGTGGATCTCGAGATCCACAATCTGCCGGTACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002675.x-1497s1c1
Sequence:CCGGGCCAGTGTACGCCTTCTCCATCTCGAGATGGAGAAGGCGTACACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002675
VALIDATED
PML MISSION shRNA Lentiviral Transduction Particles
promyelocytic leukemia
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-1371s21c1
Sequence:CCGGAGGGACCCTATTGACGTTGACCTCGAGGTCAACGTCAATAGGGTCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-1500s21c1
Sequence:CCGGGTGTACGCCTTCTCCATCAAACTCGAGTTTGATGGAGAAGGCGTACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-282s21c1
Sequence:CCGGTCGGAGGAGGAGTTCCAGTTTCTCGAGAAACTGGAACTCCTCCTCCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-1982s21c1
Sequence:CCGGCCTCAAGATTGACAATGAAAGCTCGAGCTTTCATTGTCAATCTTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-492s21c1
Sequence:CCGGGTGTACCGGCAGATTGTGGATCTCGAGATCCACAATCTGCCGGTACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-680s21c1
Sequence:CCGGCACCCGCAAGACCAACAACATCTCGAGATGTTGTTGGTCTTGCGGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002675.3-1322s21c1
Sequence:CCGGAGATGCAGCTGTATCCAAGAACTCGAGTTCTTGGATACAGCTGCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002675.x-681s1c1
Sequence:CCGGCACCCGCAAGACCAACAACATCTCGAGATGTTGTTGGTCTTGCGGGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002675.x-1548s1c1
Sequence:CCGGCAATACAACGACAGCCCAGAACTCGAGTTCTGGGCTGTCGTTGTATTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002675.x-1501s1c1
Sequence:CCGGGTGTACGCCTTCTCCATCAAACTCGAGTTTGATGGAGAAGGCGTACACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002675.x-493s1c1
Sequence:CCGGGTGTACCGGCAGATTGTGGATCTCGAGATCCACAATCTGCCGGTACACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002675.x-1497s1c1
Sequence:CCGGGCCAGTGTACGCCTTCTCCATCTCGAGATGGAGAAGGCGTACACTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008884
VALIDATED
PML MISSION shRNA Bacterial Glycerol Stock
promyelocytic leukemia
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008884.5-608s21c1
Sequence:CCGGTGGCTGATCTCCGCGACAATTCTCGAGAATTGTCGCGGAGATCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008884.5-2048s21c1
Sequence:CCGGTCCAGACCCTGAGTGATATTACTCGAGTAATATCACTCAGGGTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008884.5-4254s21c1
Sequence:GTACCGGTTCAGTTGATGGTGGATTAATCTCGAGATTAATCCACCATCAACTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008884.5-648s21c1
Sequence:CCGGCAGTACGCGCAAGTCCAATATCTCGAGATATTGGACTTGCGCGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008884.2-2178s1c1
Sequence:CCGGGCCCAGCATATCTACTCCTTTCTCGAGAAAGGAGTAGATATGCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008884.2-780s1c1
Sequence:CCGGGCACAGATGTGCTCAGCTATACTCGAGTATAGCTGAGCACATCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008884.2-144s1c1
Sequence:CCGGCAAGCCATACAGGAGGAATTTCTCGAGAAATTCCTCCTGTATGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008884.2-1946s1c1
Sequence:CCGGCCAGACCCTGAGTGATATTAACTCGAGTTAATATCACTCAGGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008884.2-1328s1c1
Sequence:CCGGCGAAGATTGCTCCAGGAAGATCTCGAGATCTTCCTGGAGCAATCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008884.5-775s21c1
Sequence:CCGGAGCCATCTCCATTGCGATATTCTCGAGAATATCGCAATGGAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008884
VALIDATED
PML MISSION shRNA shRNA Plasmid DNA
promyelocytic leukemia
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008884.5-608s21c1
Sequence:CCGGTGGCTGATCTCCGCGACAATTCTCGAGAATTGTCGCGGAGATCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008884.5-2048s21c1
Sequence:CCGGTCCAGACCCTGAGTGATATTACTCGAGTAATATCACTCAGGGTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008884.5-4254s21c1
Sequence:GTACCGGTTCAGTTGATGGTGGATTAATCTCGAGATTAATCCACCATCAACTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008884.5-648s21c1
Sequence:CCGGCAGTACGCGCAAGTCCAATATCTCGAGATATTGGACTTGCGCGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008884.2-2178s1c1
Sequence:CCGGGCCCAGCATATCTACTCCTTTCTCGAGAAAGGAGTAGATATGCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008884.2-780s1c1
Sequence:CCGGGCACAGATGTGCTCAGCTATACTCGAGTATAGCTGAGCACATCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008884.2-144s1c1
Sequence:CCGGCAAGCCATACAGGAGGAATTTCTCGAGAAATTCCTCCTGTATGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008884.2-1946s1c1
Sequence:CCGGCCAGACCCTGAGTGATATTAACTCGAGTTAATATCACTCAGGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008884.2-1328s1c1
Sequence:CCGGCGAAGATTGCTCCAGGAAGATCTCGAGATCTTCCTGGAGCAATCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008884.5-775s21c1
Sequence:CCGGAGCCATCTCCATTGCGATATTCTCGAGAATATCGCAATGGAGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008884
VALIDATED
PML MISSION shRNA Lentiviral Transduction Particles
promyelocytic leukemia
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008884.5-608s21c1
Sequence:CCGGTGGCTGATCTCCGCGACAATTCTCGAGAATTGTCGCGGAGATCAGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008884.5-2048s21c1
Sequence:CCGGTCCAGACCCTGAGTGATATTACTCGAGTAATATCACTCAGGGTCTGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008884.5-4254s21c1
Sequence:GTACCGGTTCAGTTGATGGTGGATTAATCTCGAGATTAATCCACCATCAACTGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008884.5-648s21c1
Sequence:CCGGCAGTACGCGCAAGTCCAATATCTCGAGATATTGGACTTGCGCGTACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008884.2-2178s1c1
Sequence:CCGGGCCCAGCATATCTACTCCTTTCTCGAGAAAGGAGTAGATATGCTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008884.2-780s1c1
Sequence:CCGGGCACAGATGTGCTCAGCTATACTCGAGTATAGCTGAGCACATCTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008884.2-144s1c1
Sequence:CCGGCAAGCCATACAGGAGGAATTTCTCGAGAAATTCCTCCTGTATGGCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008884.2-1946s1c1
Sequence:CCGGCCAGACCCTGAGTGATATTAACTCGAGTTAATATCACTCAGGGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008884.2-1328s1c1
Sequence:CCGGCGAAGATTGCTCCAGGAAGATCTCGAGATCTTCCTGGAGCAATCTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008884.5-775s21c1
Sequence:CCGGAGCCATCTCCATTGCGATATTCTCGAGAATATCGCAATGGAGATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)