EMAIL THIS PAGE TO A FRIEND

PMM1

phosphomannomutase 1

39 Gene Product Result for
Synonyms: Sec53
UniProtKB ID: Q92871, A8K003, Q92586
Gene ID:
Human(5372) Summary: Phosphomannomutase catalyzes the conversion between D-mannose 6-phosphate and D-mannose 1-phosphate which is a substrate for GDP-mannose synthesis. GDP-mannose is used for synthesis of dolichol-phosphate-mannose, which is essential for N-linked glycosylation and thus the secretion of several glycoproteins as well as for the synthesis of glycosyl-phosphatidyl-inositol (GPI) anchored proteins. [provided by RefSeq, Jul 2008]
Mouse(29858) phosphomannomutase 1
Rat(300089) phosphomannomutase 1
chicken(417989) phosphomannomutase 1
dog(474486) phosphomannomutase 1
domestic cat(101080900) phosphomannomutase 1
domestic guinea pig(100716730) phosphomannomutase 1
naked mole-rat(101704182) phosphomannomutase 1
cow(537070) phosphomannomutase 1
sheep(101103393) phosphomannomutase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002676 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU010471 MISSION® esiRNA esiRNA targeting mouse Pmm1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002676 Rosetta Predictions human pricing
NM_001008323 Rosetta Predictions rat pricing
NM_013872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059376 predicted 807
2 SASI_Hs01_00059377 predicted 626
3 SASI_Hs01_00059379 predicted 841
4 SASI_Hs01_00059380 predicted 827
5 SASI_Hs02_00334243 predicted 271
6 SASI_Hs01_00059381 predicted 374
7 SASI_Hs01_00059382 predicted 671
8 SASI_Hs01_00059383 predicted 205
9 SASI_Hs01_00059384 predicted 744
10 SASI_Hs01_00059385 predicted 235
11 SASI_Hs01_00059378 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081955 predicted 277
2 SASI_Rn01_00081956 predicted 701
3 SASI_Rn01_00081957 predicted 697
4 SASI_Rn01_00081958 predicted 397
5 SASI_Rn01_00081959 predicted 246
6 SASI_Rn01_00081960 predicted 628
7 SASI_Rn01_00081961 predicted 399
8 SASI_Rn01_00081962 predicted 589
9 SASI_Rn01_00081963 predicted 397
10 SASI_Rn01_00081964 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163375 predicted 891
2 SASI_Mm01_00163376 predicted 272
3 SASI_Mm01_00163377 predicted 305
4 SASI_Mm01_00163378 predicted 279
5 SASI_Mm01_00163379 predicted 696
6 SASI_Mm01_00163380 predicted 985
7 SASI_Mm01_00163381 predicted 725
8 SASI_Mm01_00163382 predicted 454
9 SASI_Mm01_00163383 predicted 478
10 SASI_Mm01_00163384 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002676
VALIDATED
PMM1 MISSION shRNA Bacterial Glycerol Stock
phosphomannomutase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002676.2-458s21c1
Sequence:CCGGGAATGGCATGCTGAACATCTCCTCGAGGAGATGTTCAGCATGCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_002676.1-127s1c1
Sequence:CCGGGCTACGAAGTAGAGTGCAGATCTCGAGATCTGCACTCTACTTCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002676.1-316s1c1
Sequence:CCGGGCTGCAGGACTTGATCAACTTCTCGAGAAGTTGATCAAGTCCTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002676.1-466s1c1
Sequence:CCGGCGAACTGGACAAGAAAGAGAACTCGAGTTCTCTTTCTTGTCCAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002676.2-885s21c1
Sequence:CCGGAGAGTTTGGCCTAGGCCTAAACTCGAGTTTAGGCCTAGGCCAAACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002676.1-160s1c1
Sequence:CCGGCGGCTCTGACTACTGTAAGATCTCGAGATCTTACAGTAGTCAGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002676.1-376s1c1
Sequence:CCGGGCGTGGAACCTTCATCGAGTTCTCGAGAACTCGATGAAGGTTCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002676.2-1089s21c1
Sequence:CCGGGCCACAGCTGCTGCTTGTATTCTCGAGAATACAAGCAGCAGCTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002676.2-802s21c1
Sequence:CCGGTGCAGCGATGCCGGGAGATTTCTCGAGAAATCTCCCGGCATCGCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002676.2-703s21c1
Sequence:CCGGACTTCTTTGGGAACGAGACTACTCGAGTAGTCTCGTTCCCAAAGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002676
VALIDATED
PMM1 MISSION shRNA shRNA Plasmid DNA
phosphomannomutase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002676.2-458s21c1
Sequence:CCGGGAATGGCATGCTGAACATCTCCTCGAGGAGATGTTCAGCATGCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_002676.1-127s1c1
Sequence:CCGGGCTACGAAGTAGAGTGCAGATCTCGAGATCTGCACTCTACTTCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002676.1-316s1c1
Sequence:CCGGGCTGCAGGACTTGATCAACTTCTCGAGAAGTTGATCAAGTCCTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002676.1-466s1c1
Sequence:CCGGCGAACTGGACAAGAAAGAGAACTCGAGTTCTCTTTCTTGTCCAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002676.2-885s21c1
Sequence:CCGGAGAGTTTGGCCTAGGCCTAAACTCGAGTTTAGGCCTAGGCCAAACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002676.1-160s1c1
Sequence:CCGGCGGCTCTGACTACTGTAAGATCTCGAGATCTTACAGTAGTCAGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002676.1-376s1c1
Sequence:CCGGGCGTGGAACCTTCATCGAGTTCTCGAGAACTCGATGAAGGTTCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002676.2-1089s21c1
Sequence:CCGGGCCACAGCTGCTGCTTGTATTCTCGAGAATACAAGCAGCAGCTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002676.2-802s21c1
Sequence:CCGGTGCAGCGATGCCGGGAGATTTCTCGAGAAATCTCCCGGCATCGCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002676.2-703s21c1
Sequence:CCGGACTTCTTTGGGAACGAGACTACTCGAGTAGTCTCGTTCCCAAAGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002676
VALIDATED
PMM1 MISSION shRNA Lentiviral Transduction Particles
phosphomannomutase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002676.2-458s21c1
Sequence:CCGGGAATGGCATGCTGAACATCTCCTCGAGGAGATGTTCAGCATGCCATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_002676.1-127s1c1
Sequence:CCGGGCTACGAAGTAGAGTGCAGATCTCGAGATCTGCACTCTACTTCGTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002676.1-316s1c1
Sequence:CCGGGCTGCAGGACTTGATCAACTTCTCGAGAAGTTGATCAAGTCCTGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002676.1-466s1c1
Sequence:CCGGCGAACTGGACAAGAAAGAGAACTCGAGTTCTCTTTCTTGTCCAGTTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000414558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002676.2-885s21c1
Sequence:CCGGAGAGTTTGGCCTAGGCCTAAACTCGAGTTTAGGCCTAGGCCAAACTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002676.1-160s1c1
Sequence:CCGGCGGCTCTGACTACTGTAAGATCTCGAGATCTTACAGTAGTCAGAGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000049067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002676.1-376s1c1
Sequence:CCGGGCGTGGAACCTTCATCGAGTTCTCGAGAACTCGATGAAGGTTCCACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000442113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002676.2-1089s21c1
Sequence:CCGGGCCACAGCTGCTGCTTGTATTCTCGAGAATACAAGCAGCAGCTGTGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000434366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002676.2-802s21c1
Sequence:CCGGTGCAGCGATGCCGGGAGATTTCTCGAGAAATCTCCCGGCATCGCTGCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000428849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002676.2-703s21c1
Sequence:CCGGACTTCTTTGGGAACGAGACTACTCGAGTAGTCTCGTTCCCAAAGAAGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013872
PMM1 MISSION shRNA Bacterial Glycerol Stock
phosphomannomutase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013872.3-608s21c1
Sequence:CCGGTCTCCCGAGGAGGCATGATAACTCGAGTTATCATGCCTCCTCGGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013872.3-220s21c1
Sequence:CCGGGGTGGCTCTGACTACTCTAAGCTCGAGCTTAGAGTAGTCAGAGCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013872.1-695s1c1
Sequence:CCGGCATCATCCACTTCTTTGGAAACTCGAGTTTCCAAAGAAGTGGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013872.1-518s1c1
Sequence:CCGGGTTCTCGGAACTGGACAAGAACTCGAGTTCTTGTCCAGTTCCGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013872.1-312s1c1
Sequence:CCGGCAGTATAAACACGGACGGCTACTCGAGTAGCCGTCCGTGTTTATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013872.3-278s21c1
Sequence:CCGGAGAAGTTTGACTACGTGTTTGCTCGAGCAAACACGTAGTCAAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013872.3-901s21c1
Sequence:CCGGGGCCTGAAGATAGAACCATTGCTCGAGCAATGGTTCTATCTTCAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013872.3-302s21c1
Sequence:CCGGAGAATGGGACAGTGCAGTATACTCGAGTATACTGCACTGTCCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013872
PMM1 MISSION shRNA shRNA Plasmid DNA
phosphomannomutase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013872.3-608s21c1
Sequence:CCGGTCTCCCGAGGAGGCATGATAACTCGAGTTATCATGCCTCCTCGGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013872.3-220s21c1
Sequence:CCGGGGTGGCTCTGACTACTCTAAGCTCGAGCTTAGAGTAGTCAGAGCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013872.1-695s1c1
Sequence:CCGGCATCATCCACTTCTTTGGAAACTCGAGTTTCCAAAGAAGTGGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013872.1-518s1c1
Sequence:CCGGGTTCTCGGAACTGGACAAGAACTCGAGTTCTTGTCCAGTTCCGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013872.1-312s1c1
Sequence:CCGGCAGTATAAACACGGACGGCTACTCGAGTAGCCGTCCGTGTTTATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013872.3-278s21c1
Sequence:CCGGAGAAGTTTGACTACGTGTTTGCTCGAGCAAACACGTAGTCAAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013872.3-901s21c1
Sequence:CCGGGGCCTGAAGATAGAACCATTGCTCGAGCAATGGTTCTATCTTCAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013872.3-302s21c1
Sequence:CCGGAGAATGGGACAGTGCAGTATACTCGAGTATACTGCACTGTCCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013872
PMM1 MISSION shRNA Lentiviral Transduction Particles
phosphomannomutase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013872.3-608s21c1
Sequence:CCGGTCTCCCGAGGAGGCATGATAACTCGAGTTATCATGCCTCCTCGGGAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013872.3-220s21c1
Sequence:CCGGGGTGGCTCTGACTACTCTAAGCTCGAGCTTAGAGTAGTCAGAGCCACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013872.1-695s1c1
Sequence:CCGGCATCATCCACTTCTTTGGAAACTCGAGTTTCCAAAGAAGTGGATGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000184541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013872.1-518s1c1
Sequence:CCGGGTTCTCGGAACTGGACAAGAACTCGAGTTCTTGTCCAGTTCCGAGAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000195862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013872.1-312s1c1
Sequence:CCGGCAGTATAAACACGGACGGCTACTCGAGTAGCCGTCCGTGTTTATACTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013872.3-278s21c1
Sequence:CCGGAGAAGTTTGACTACGTGTTTGCTCGAGCAAACACGTAGTCAAACTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013872.3-901s21c1
Sequence:CCGGGGCCTGAAGATAGAACCATTGCTCGAGCAATGGTTCTATCTTCAGGCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013872.3-302s21c1
Sequence:CCGGAGAATGGGACAGTGCAGTATACTCGAGTATACTGCACTGTCCCATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???